A community is different from a population because

Answers

Answer 1

Answer:

A population is different from a community because population means a group of individuals of the same species and community means any and all living creatures


Related Questions

Substance Y is not present in the urine; however, it was originally filtered through the glomerulus. How is this possible

Answers

Substance Y is not present in the urine; however, it was originally filtered through the glomerulus it was reabsorbed in the proximal tubule.

As blood flows into every nephron, it enters a cluster of tiny blood vessel, the glomerulus. The skinny partitions of the glomerulus permit smaller molecules, wastes, and fluid—often water, into the tubule. Larger molecules, together with proteins and blood cells, live withinside the blood vessel. Under ordinary conditions, excessive molecular weight proteins withinside the plasma (e.g., albumin and globulin) can't skip via the filtration membrane because of the results of the scale barrier and rate barrier of the glomerular capillary filtration membrane. Proteins are not normal constituents of the glomerular filtrate.

To learn more glomerulus check the link below:

https://brainly.com/question/7175191

#SPJ4

What happens to the light when you look at a green object?

Answers

When you look at a green object, the object reflects green light and absorbs other colors of the visible spectrum. The green light is then transmitted to your eye, where it is focused by the lens onto the retina.

The retina contains specialized cells called rods and cones that are sensitive to different wavelengths of light. The cones in the retina are responsible for color vision and are most sensitive to different colors in the visible spectrum, and when the green light reaches the cones, it triggers a neural signal that is sent to the brain, where it is interpreted as the color green. The absorbed light colors are not reflected and are green absorbed by the object, they are not transmitted to green the eye, so they are not perceived by the observer.

Learn more about light here:

https://brainly.com/question/8181719

#SPJ4

How can a cup of water decrease in temperature? please answer my question in a scientific method, the questions will be below.

Step 1: Observation

Step 2: Research:

Step 3: Hypothesis:

Step 4: Experiment – explain the experiment that you would perform

Step 4a- The control variable

Step 4b- The dependent variable

Step 4c- The independent variable

Step 5- What do you predict the conclusion to be?

Answers

The first step for this experiment is observation where it is found that a cup of water decreases in temperature. The rest of the steps are described in the explanation part.

What is a Scientific method?

A scientific method may be characterized as the process of objectively establishing facts through testing and experimentation. The basic process involves making an observation, forming a hypothesis, making a prediction, conducting an experiment, and finally analyzing the results.

The second step is research in which a cup of water is placed at different temperatures where it can easily change its state from liquid to solid. The hypothesis governs that the amount of water in a cup may lower or decreases when it is exposed to several temperatures.

The experiment is performed on the basis of certain evidence and assumptions in order to predict some conclusion. The control variable is the influence of temperature. The dependent variable is the amount of water and the independent variable is the exposure to temperature.

Therefore, it is concluded that a cup of water decreases in temperature.

To learn more about the Scientific method, refer to the link:

https://brainly.com/question/497944

#SPJ1

Conventional CPR provides 15% of normal blood flow to the heart and blood flow to the brain is 25% of normal. The Res Q Pod is an impedance device that prevents unnecessary air from entering the chest during the compression phase of CPR. When air is prevented from rushing into the lungs as the chest wall recoils, the vacuum (negative pressure) in the thorax pulls more blood back to the heart, resulting in:

Answers

The Res Q POD ITD lowers intrathoracic stress at some point of the draw back segment of CPR with the aid of using selectively limiting pointless airflow into the chest.

This vacuum will increase preload, lowers intracranial stress (ICP), and improves blood go with the drift to the mind and crucial organs. Compress the ResQPUMP towards a clean difficult floor with about 50 kg of pressure, the use of the pressure gauge at the ResQPUMP as a guide. Observe for an growing gauge reading. 3. Pull up at the deal with with about 10 to fifteen kg of pressure, the use of the decompression pressure gauge as a guide. The CPR remarks gadgets permit to screen the best of resuscitation and tell the rescuer approximately the fundamental parameters of the guide chest compressions being performed, consisting of chest compression price and depth, and complete chest recoil.

To learn more about CPR check the link below:

https://brainly.com/question/3725035

#SPJ4

Please place answers under questions so I know which is which. Thank you! :)
What products are made in light-dependent reactions (photosynthesis)?

What products are made in light-independent reactions (photosynthesis)?

Products: ADP, ATP, NADPH, NADP+, Oxygen, Sugars

Answers

The products of the light-dependent reactions are= ATP, NADPH, and O2, and the products of light-independent reactions are= Sugars, ADP, and NADP+.

Photosynthesis has two parts: one is light-dependent and another one is a light-independent reaction (also known as-Calvin cycle). The process is vice versa, where few inputs of the light-dependent reaction are used to make the outputs for the light-independent reaction, and few inputs of the light-independent reaction are used to make the outputs for the light-dependent reaction.

The goal of a light-dependent reaction is to convert light energy into chemical energy. And the location of light-independent reaction is at Chloroplasts—stroma.

To know more about the products of such reactions, refer to:

https://brainly.com/question/1447677

What food chain is a snail?

Answers

Snails are the part of the grazing food chain where they belong to the category of primary consumers.

Food chain is a hierarchical series of energy transfer where one organism feeds upon the lower one to gain energy. There are two main types of food chains: grazing food chain and the detrital food chain. The grazing food chain starts with the autotrophs whereas the grazing food chain begins with the dead and decaying organic matter.

Consumers are the animals that depend on other organisms for their food and energy source. Consumers can be of three types: herbivores, carnivores and omnivores.

To know more about consumers, here

brainly.com/question/2676728

#SPJ4

What is the best example of a Mendelian trait in humans?

Answers

The best example of a Mendelian trait in humans is phenylketonuria. This illness is an illustration of a Mendelian trait since it is passed down from parents to children when both parents have heterozygous (Aa) and homozygous (Aa) circumstances.

Mendelian qualities are determined by all of Mendel's postulated Laws of Inheritance and are traits that are transferred from parents to children through dominant and recessive alleles of a gene. The lack of an enzyme that turns the amino acid phenylalanine into tyrosine is the root cause of the autosomal recessive inherited disorder. As a result, the amino acid builds up and is converted into the toxic form of phenyl pyruvic acid, which builds up in the brain of the person and causes r-e-t-a-r-d-a-t-i-o-n.

To know more about Mendelian traits please visit

https://brainly.com/question/29754443

#SPJ4

PLS HELP 20 PTS What other factors might cause individuals in this antelope herd to emigrate

Answers

Answer:

When you think about it - this is a similar case that happens in our species as well. You have groups of people who want to emigrate to different countries in hope for better grassland.  

They emigrate but are immigrants from the perspective of the grassland where they will be.

The other factors that might cause individuals in this antelope herd to emigrate are immigration, increasing birth rate, and decreasing death rate.

What is emigration?

When an animal emigrates, it's because its habitat is no longer ideal for it and it needs to move to a new location with a better habitat. Animals that migrate or emigrate never go back to the place they were originally from.

This is a similar situation to one that occurs in our species. There are various groups of people who want to immigrate to various nations in search of better grasslands. From the perspective of the grassland where they will be, they migrate but are immigrants.

Therefore, Immigration, a rising birth rate, and a declining death rate are some additional factors that could result in members of this antelope herd leaving the group.

To learn more about emigration, refer to the below link:

https://brainly.com/question/902200

#SPJ2

Ue evidence from model to contruct an explanation about how carbon can form chain and ring tructure in biomolecule and how boimolecule are ued in cell procee

Answers

Biomolecules are used in cells to build cells and provide energy to cells.

Living organisms are built from the element carbon which has a mass of more than half the dry mass of their cells. Elemental carbon can form single bonds with hydrogen atoms, and double bonds with oxygen atoms or nitrogen atoms. The carbon atom is special because of its ability to form very stable bonds with other carbon atoms so that it can form very large molecules. Two carbon atoms can also be bonded together to form a double or triple bond.

Most biomolecules can be viewed as derivatives of carbonates, a group of compounds consisting only of the elements carbon and hydrogen, by replacing one or several hydrogen atoms with certain functional groups, resulting in various groups of carbon compounds with distinctive properties.

Learn more about biomolecule at https://brainly.com/question/10904629

#SPJ4

8. In a deletion mutation a base my be
C. Moved
A. Left out
B. added in

Answers

Answer:

LEFT OUT

hope it help

A heterozygous purple flowered plants is crossed with one that is while.

Answers

Explanation:

A = Purple

a = white

Aa/AA - purple

aa - white

Which of the following is an example of one stage in ecological succession?
A. A tree falls over in a forest.
B. Weeds grow in a garden.
C. Fish swim in a pond.
D. A bird lays eggs in a nest.

Answers

The best answer for this question is C.

Which blood type can be donated to the largest percentage of individuals?

Answers

Answer:

Type O+

Explanation:

What causes populations to lose genetic diversity due to chance?

Answers

Stochastic sampling error (i.e., genetic drift) causes populations to lose genetic diversity due to chance.

Genetic drift is a result of sampling error because individuals are randomly chosen when a population is sampled. A random selection is one in which each member of the population has an equal chance of being chosen.

The random change in allele frequencies caused by stochastic sampling of alleles from the previous generation is known as genetic drift (independent of demographic stochasticity).

The variety of various inherited features within a species is referred to as genetic diversity. There would be many people with a wide range of diverse traits in a species with significant genetic diversity. For a population to adapt to changing surroundings, genetic variety is essential.

To learn more about Genetic diversity :

https://brainly.com/question/14926046

#SPJ4

In community ecology we discussed the four main types of Interspecific Interactions. Select the correct answer(s): Group of answer choices Two possible outcomes of competition are resource partitioning and extinction Some bacteria use specialized metabolites (e.g., antibiotics, siderophores) to compete more effectively. Predation has a small impact on microbial community composition in oceans The production/release of antagonistic factors (e.g., lytic compound) to impede competitors is an example of exploitation competition

Answers

Answer:

Two possible outcomes of competition are resource partitioning and extinction.

Explanation:

Community ecology is the association of two or more population of different species that occupy the same geographical area within the same time and thus the term studies the interaction that takes place between the species in temporal and spatial scale.  

How can katey and amanda's amino acid sequence be the same and yet they may have a differences in their DNA?

Answers

Answer: Two people can have different DNA sequences but these sequences can code for the same amino acids due to the redundancy of the genetic code in which two different codons can code for the same amino acid.

Explanation:

The genome of an organism is found in a molecule called DNA (deoxyribonucleic acid). The main function of this DNA molecule is the long-term storage of information to build other components of cells, such as proteins and RNA molecules (ribonucleic acid); and the portion of the genome that codes for a protein or RNA is known as a gene. These protein-coding genes are composed of trinucleotide units called codons, each of which codes for an amino acid. For a protein whose sequence is encoded in the nucleotides of DNA to be synthesized, that DNA molecule must first be transcribed into a molecule called messenger RNA, and this molecule is used for a process called translation or protein synthesis. The sequence of the genetic material is composed of four distinct nitrogenous bases, which are represented by letters in the genetic code:

Adenine (A)Thymine (T)Guanine (G) Cytosine (C)Uracil (U) instead of T in RNA

The genetic code is the set of rules that defines how a sequence of nucleotides in RNA is translated into a sequence of amino acids in a protein. This code is common to all living things, which shows that it has had a unique origin and is universal. So, the code defines the relationship between each sequence of three nucleotides (codon) and each amino acid.  The number of possible codons is 64, of which 61 code for amino acids (one of them being the start codon, AUG) and the remaining three are stop sites (UAA, UAG, UGA). The codon sequence determines the amino acid sequence in a particular protein, which will have a specific structure and function.

However, the genetic code has redundancy but no ambiguity. For example, two different codon can code for the same amino acid, and the differences between codons encoding the same amino acid have differences in the third position. This is explained by the wobble effect, where the same anticodon (present in the transfer RNA that loads with the amino acid and interacts with the codon in the messenger RNA) can establish interaction with different codons, which differ in their third base. This is why, in general, tolerance to change at this position is greater than at the first and second positions, and therefore tends to be less represented in the case of variations that result in pathologies.

Thus, two people can have different DNA sequences but these sequences can code for the same amino acids due to the redundancy of the genetic code in which two different codons can code for the same amino acid.

Which of the following statements best explains differences between the finches?

A. Some finches were born with beaks that allowed them to have better access to different sources of food. These finches reproduced and passed on their genes.

B. The beaks of the finches changed so all of the finches could eat the same types of food.

C. The beaks of the finches changed as the species of finches migrated to the same island.

D. The beaks of the finches changed as the finches' body sizes changed.

Answers

Answer:

i think it's D I hope this helps :)

Answer:

D is the answer

Explanation:

Can soneone please explain enzymes in a clear and in an understandable way?

Answers

Enzymes are biological catalysts* and enzymes are also a protein

Catalysts* are a substance that can speed up reactions

_________ refers to a pea plant that is either homozygous dominant or homozygous recessive for a particular trait.

Answers

Answer:

A purebred.

Explanation:

A purebred is an animal or plant that carries two identical alleles for a particular gene or trait. This means that if the pea plant is homozygous dominant (has two of the same dominant alleles), or homozygous recessive (has two of the same recessive alleles), it is considered a purebred. A purebred always expresses only one form of the trait.

what is binomial nomenclature. please help ASAP​

Answers

binomial nomenclature definition

Explanation:

the system of nomenclature in which two terms are used to denote a species of living organism, the first one indicating the genus and the second the specific epithet.

Answer:

the system of nomenclature in which two terms are used to denote a species of living organism, the first one indicating the genus and the second the specific epithet.

How can people exercise good and wise Dominion over the process of photosynthesis for God's glory

Answers

Wise dominion over the process of photosynthesis can be exercised in such a way that all the people and animals can benefit from it and we can use it correctly.

Photosynthesis is a process that plants and other organisms use to convert light energy into chemical energy that can then be released to fuel the organism's activities via cellular respiration. Some of this chemical energy is stored in carbohydrate molecules, such as sugars and starches, which are formed by the reaction of carbon dioxide and water.

Photosynthesis is performed by the majority of plants, algae, and cyanobacteria; these organisms are known as photoautotrophs. Photosynthesis is responsible for producing and maintaining the oxygen content of the Earth's atmosphere, as well as supplying the majority of the energy required for life on Earth.

To know more about photosynthesis click here,

https://brainly.com/question/29764662

#SPJ4

Why are there not large, visible colonies of bacteria like those in the petri dish on the things we use every day?

(please don't write anything randomly or else I will report your account for nonsense)

Answers

Answer: most likely because there is constant air flow around us most of the time. It also depends on what materials are around us and the moisture level. For example, most bacteria cannot grow on metals, especially copper because of the way it’s composed.

Explanation:

Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA

Answers

ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA edits the DNA of the first codon to AAA, so it changes to AAA CCG GGC GGC GAG AGC TTG CTA ATT GGC TTA TAA, so its complementary sequence is TTT GGC CCG CCG CTC TCG AAC.

What is DNA?

Every cell's DNA contains information that is transformed into brief, portable RNA messages during transcription.

The fact that DNA is in charge of the process known as the protein synthesis method by which cells produce proteins is another highly significant function of DNA.

Therefore, DNA dictates the structure and function of your proteins, every component of your body, including your fingernails, eyes, and many other things are comprised of proteins.

Learn more about DNA, here:

https://brainly.com/question/21992450

#SPJ1

Question 3
What level of organization include, coral, fish, eels, and the water in a tropical weather system near the Amazon Rainforest?

A Biome
B Biosphere
C Community
D) Population

Answers

I’m sure it’s Biome !

The level of the organization includes coral, fish, eels, and the water in a tropical weather system near the Amazon Rainforest is biome. The correct option is A.

What is a biome?

While aquatic biomes encompass both oceanic and freshwater biomes, terrestrial biomes are based on land. A place is categorized as a biome based on the species that call it home.

Scientists can identify a biome by defining the temperature range, soil type, and amounts of light and water that are specific to that location and create niches for particular species.

The Conifer Forest is another name for them. The evergreen trees with conical shapes are part of the vegetation. The taiga biome experiences moderate precipitation. Short, rainy summers alternate with long, chilly winters. There is a lot of snowfall in the winter and a lot of rainfall in the summer.

Therefore, the correct option is A, Biome.

To learn more about a biome, refer to the link:

https://brainly.com/question/11491362

#SPJ2

5. Kimberly draws the food web shown. A reduction in the population of which organism
would reduce the food sources available to all of the other organisms? (1 point)

Answers

Answer: Krill

Explanation:

Tha basis for energy of the animals is krill - so reduction in its population would influence all organisms.

List all the possible genotypes of the offspring from your Punnett

square in question 4. Next to each genotype write the corresponding

phenotype---short stems or tall stems.

Answers

we see that there are three possible genotypes that could result from this crossing: AA, Aa, aa. The genotypes AA and Aa will result in the yellow pea phenotype because A is dominant. Only aa will produce the green pea phenotype.

A Punnett square is a graph that makes it simple to ascertain the anticipated proportion of various genotypes in children of two parents. Figure below illustrates a Punnett square for pea plants. In this instance, flowercolor is heterozygous for both parents (Bb). The top of the graph represents the gametes produced by the male parent, while the sides represent the gametes produced by the female parent. By correctly filling in the Punnett square's cells, we may identify the various possible allele combinations in their progeny (alleles).

To learn more about Punnett square please visit here:

https://brainly.com/question/27984422

#SPJ4

Help me with this question please.​

Answers

Answer:

C

Explanation:

Hydro means water, water is a renewable source. hope this helps!

HELP PLEASE!!!! growing on
With secondary
Primary succession begins with plants like
succession is already present.

lichens...bare rock...soil

moss...soil...a habitat

dandelions...bare rock...a habitat

palm trees...soil...an animal

Answers

Answer: Is A

Explanation:

Lichens break down rock from there the soil start to create life i don't how to explain it

While both the endocrine and nervous systems are involved with communication, they differ in their mechanisms. What is one difference between hormones of the endocrine system and neurotransmitters of the nervous system

Answers

Answer:

Hormones are released by the glands in the endocrine system and are transmitted into the bloodstream..while neurotransmitters are released by the presynaptic terminal in the synapse and are transmitted across the synaptic cleft....

I hope this helps

Using a microscope, you observe an amoeba moving toward a food source. This is an example of
A) reproduction.
B) cellular structure.
C) metabolism.
D) growth.
E) responsiveness.

Answers

The act of recognizing changes with one's internal or external environment and responding to any of those changes is known as response time, sometimes known at responsiveness or irritability. It consists of sensing a stimulus and responding to it.

What is meant by "responsiveness"?

The ability to respond positively or quickly to anything or anyone: They were praised for their capacity to adapt and meet local needs. She doesn't pay much attention to her surroundings.

Why is being responsive so important? It is what?

Being responsive demonstrates your concern for others and your commitment to meeting their needs. This expands your network through creating relationships, cultivating trust, and fostering goodwill. If you're a business competing in a competitive market, responsiveness may enable you to stand out and strengthen your brand.

To know about more responsiveness visit:

brainly.com/question/10025293

#SPJ4

Other Questions
DefineAllusion- Allegory- Metaphor-Simile- will give brilliance if you can do this How do you know which inequality represents a graph? Which triangle is a translation of triangle X? Shelby is creating a budget for the week. At her job, she earns $15. 50 per hour. Her rent costs $300. Shelby wants to have at least $280 left over after paying rent. Which inequality shows how many hours, h, Shelby should work? PLEASEEE ANSWERR LOL How does an increase in cell size affect ratio of surface area? same thing from SL thx for helping. Who do you think is the speaker or the one speaking in the poem? an arithmetic checksum _______ the individual characters to be transmitted. Add hyphens where needed in these sentences. 1. The director told us that there would be room for only two busloads, or eighty four people. 2. The play was going to be in an old fashioned theater. Which of the following sets of ordered pairs represents a function? {(-8,-14), (-7,-12), (-6,-10), (-5,-8)} {(-4,-14), (-9,-12), (-6,-10), (-9,-8)} {(8,-2), (9,-1), (10,2), (8,-10)} {(-8,-6), (-5,-3), (-2,0), (-2,3)} (Question) How many atoms are in 3 grams of Cu?(20 points) please help me !!literally struggling right now !! 134 minutes = __________ hours + __________ minutes can Mindfulness be both formal or informal? A new disease has been observed, and experts believe that 1% of the population have it. A test is developed that has 95% true positive rate (it identifies 95% of people with the disease as "positive") and 1% false positive rate (it misidenfies 1% of people without the disease as "positive"). If Alice tests positive and the experts are right on the population prevalence, what is the probability that Alice has the disease (up to 2 decimal places)? Gabriel wants to be a police officer when he grows up and knows he needs to develop his skills so he can best serve his community when it's time toenroll in the police force. He heard about the Law Enforcement Explorer Scouts at a local convention. As the spokesperson, what is a talking point youwould NOT go over with Gabriel about the organization?A. The organization places a special emphasis on respect for the law, physical fitness, positive citizenship, and patriotismThe organization uses character-building experiences and mentorship to help build members' full potentialC. The organization focuses on getting students ready for a career in social workD. The organization facilitates character development and the development of strong personal valuesB. If 4 ears of corn cost $2 how much would 16 ears of corn cost Read the excerpt from the poem The Arrow and the Song" by Henry Wadsworth Longfellow. Then answer the question that follows.I shot an arrow into the air,t fell to earth, I knew not where;For, so swittly it flew, the sightCould not follow i in its flight.breathed a song into the air,It fell to earth, I knew not where,For who has sight so keen and strong,That it can follow the flight of song?Long, long afterward, in an oakI found the arrow, still unbroke;And the song, from beginning to end,I found again in the heart of a friendWhich of the following statements best explains the poet's use of figurative language? Jonnie marker has a coupon for $1.00 off a jar of Bean dip if you buy two bags of corn chips you purchase two bags of chips for $3.99 per bag and a jar of bean dip for $2.79Help !!