a company's resources and capabilities represent multiple choice the firm's net working capital and related determinants for measuring operating performance and capabilities. the firm's competitive assets that determine its competitiveness and ability to succeed in the marketplace. whether the firm has the industry's most efficient value chain. management's sources and uses of funding for new strategic initiatives. positive trends with relevant cultural factors related to buyers' choices and product modifications.

Answers

Answer 1

option (B) is the correct answer.

The resources and capabilities of a company represent the firm's competitive assets that determine its competitiveness and ability to succeed in the marketplace. The correct option is: the firm's competitive assets that determine its competitiveness and ability to succeed in the marketplace.

Explanation:Resources and capabilities are internal resources and abilities that are useful in creating and sustaining a competitive advantage. Competitive assets are a set of tools that a company uses to gain a competitive advantage over its rivals.The firm's resources and capabilities are key to the creation of a sustainable competitive advantage.

For example, a firm that has a unique, inimitable capability for producing high-quality goods at a low cost can leverage this capability to gain a cost advantage over its competitors.

Similarly, a firm that has developed strong relationships with suppliers or distributors can use these relationships to gain a supplier or distributor advantage over its rivals.

In conclusion, the firm's competitive assets determine its competitiveness and ability to succeed in the marketplace. Therefore, option (B) is the correct answer.

to know about Resources:

https://brainly.com/question/22943286

#spj11


Related Questions

what makes it different from priorities analysis, programs analysis, continuities analysis, of a systems analysis?

Answers

Systems Analysis is an interdisciplinary field that seeks to understand how individual components of a system interact with each other in order to achieve a desired outcome.

It differs from Priorities Analysis, Programs Analysis, and Continuities Analysis in that it considers the interrelationships between all components in the system, rather than just looking at each one individually. System Analysis seeks to identify and quantify the effects of changes within a system and how those changes will affect other components in the system. This is an important skill in engineering and business, as it allows one to make decisions based on the data and analysis of a system.

It also helps to identify weaknesses in a system that could be exploited to gain a competitive advantage. Systems Analysis also involves anticipating potential problems and taking steps to mitigate them before they can become an issue.

For such more questions on Systems Analysis

https://brainly.com/question/30364965

#SPJ11

which of the following economic changes are consistent with cost-push inflation? check all that apply.a sudden and sharp decline in the quantity of money issued by the central bankfalling economic ou

Answers

The economic changes that are consistent with cost-push inflation are:

A sudden and sharp decline in the quantity of money issued by the central bank.Falling economic output and employment.A sharp increase in the prices of raw materials, such as oil, food, and metals.

Cost-push inflation is a term used to describe the upward pressure on prices caused by a rise in production costs. This is frequently triggered by a reduction in the supply of a necessary component or by an increase in the cost of production. Here are the economic changes that are consistent with cost-push inflation:

A sudden and sharp decline in the quantity of money issued by the central bankWhen the central bank prints less money, the supply of money in the economy is reduced, which means that people and companies have less money to spend. As a result, the economy contracts, causing a rise in prices.

Falling economic output and employmentWhen there is a decline in economic output and employment, people and businesses have less money to spend, which results in a decrease in the demand for goods and services. This, in turn, puts downward pressure on prices.

A sharp increase in the prices of raw materials, such as oil, food, and metals

A rise in the price of raw materials causes a rise in production costs, which, in turn, leads to a rise in prices. This is because businesses will have to pay more to produce the goods and services they offer, and they will have to pass on those costs to consumers, resulting in higher prices.

Learn more about economic changes: https://brainly.com/question/1690575

#SPJ11

25% DECISION POINT: CHOOSING YOUR TARGET MARKET
The VP of Marketing directs you to begin looking at markets for Powerfully Fit's products:
"Assuming that we focus on the desire for fitness technology functionality, what market do you think would benefit most from our offerings?"
Select an option from the choices below and click Submit.
a) Gym Newbie: This largest market is new to fitness and working out. Gym newbies work out once a week and are price sensitive about their fitness spending.
b) Weekend Warriors: This large market works out 2-3 times a week and mixes up running with gym time. Weekend warriors typically purchase mid-level shoes and apparel and use a fitness app on their phone to track their workouts.
c) Marathon Madness: This mid-size market works out daily. Workouts often include long distance runs. Quality, durable products are attractive to this market, and marathoners are willing to pay premium prices to get the latest tech.

Answers

Based on the VP of Marketing criteria criteria of focusing on the desire for fitness technology functionality, I believe that the Marathon Madness market would benefit most from Powerfully Fit's offerings.

What is the marketing strategy used?

This market works out daily and values quality, durable products, which aligns with the features of Powerfully Fit's products. Additionally, marathoners are willing to pay premium prices for the latest tech, making them a lucrative target market for the company.

This market would benefit most from your offerings, as they work out daily and prioritize quality, durable products. They are also willing to pay premium prices for the latest fitness technology functionality.

To know more about Marketing visit:

https://brainly.com/question/26122334

#SPJ11

the demand for calculus textbooks is inelastic. which statement would explain this phenomenon? group of answer choices many alternative textbooks can be used as substitutes. students have a lot of time to adjust to price changes. textbook purchases consume a large portion of most students' income. textbooks are a necessity for most students.

Answers

the statement that would explain this phenomenon is: Textbooks are a necessity for most students.

The inelasticity of demand for calculus textbooks can be explained by the fact that textbooks are a necessity for most students.

What is Inelastic Demand?

Inelastic demand is when the quantity demanded is not affected by a change in price. When the percentage change in quantity demanded is less than the percentage change in price, it's said to be inelastic.

The demand is said to be inelastic when the change in price has little or no impact on the quantity of goods demanded.The demand for calculus textbooks is inelastic because calculus textbooks are a necessity for most students.

Calculus is a subject that requires specific materials, and students can only get those materials by purchasing a calculus textbook. Although there may be alternative textbooks that can be used as substitutes, they may not cover the required materials as thoroughly as a calculus textbook, which is specifically designed for that subject.

As a result, students have no choice but to buy a calculus textbook to study the subject properly. As a result, the demand for calculus textbooks is inelastic.

The quantity demanded of calculus textbooks does not vary much, if at all, in response to price changes because they are so essential for students studying calculus.

To know more about Inelastic Demand here

https://brainly.com/question/28192591

#SPJ11

given a fixed level of sales and a constant profit margin, an increase in the accounts payable period can result from: group of answer choices an increase in the cost of goods sold account value. an increase in the cash cycle. an increase in the ending accounts payable balance. a decrease in the operating cycle. a decrease in the average accounts payable balance.

Answers

It is important to note that while an increase in the accounts payable period can improve a company's cash flow in the short term.

An increase in the accounts payable period can result from an increase in the ending accounts payable balance.

The accounts payable period is the length of time it takes a company to pay its suppliers for goods or services purchased on credit. It is calculated by dividing the ending accounts payable balance by the cost of goods sold per day.

If the ending accounts payable balance increases, it means that the company is taking longer to pay its suppliers. This could be due to a number of reasons, such as negotiating longer payment terms with suppliers, experiencing temporary cash flow constraints, or intentionally stretching out payments to preserve cash.

Learn more about cash flow here https://brainly.com/question/29768594

#SPJ4

what term describes the stock market when prices have been steadily rising and people are optimistic? group of answer choices bull market neutral market bear market steady market

Answers

The term that describes the stock market when prices have been steadily rising and people are optimistic is bull market.

What is the bull market?

A bull market is a situation in which stock prices are rising, and the economy is in a stable position. It is marked by positive investor sentiment and high market confidence. It is distinguished by a period of sustained growth and a positive trend that usually leads to higher prices. The Bull market is characterized by high levels of market activity and optimism among investors.

What is a bear market?

The bear market is a situation where the stock market experiences a decline. It is marked by negative investor sentiment and low market confidence. It is distinguished by a negative trend that usually leads to lower prices. Bear markets usually occur when the economy is in a recession or when interest rates are high. Investors tend to be pessimistic in this market.

However, the neutral market is characterized by a state of the stock market where there is no significant movement in either direction. Investors and traders usually take a wait-and-see approach in this type of market. They usually make investment decisions based on company fundamentals rather than market trends.

Therefore, the term that describes the stock market when prices have been steadily rising and people are optimistic is a bull market.

Learn more about bull market at

https://brainly.com/question/885607

#SPJ11

What is a primary difference between business and consumer buyers?
a. Consumer buyers require more product information than business buyers.
b. Business purchases are made by one individual whereas families make consumer purchases together.
c. Repeat sales are more common with consumer buyers than business buyers.
d. Consumers primarily buy inexpensive items; businesses only buy expensive items.
e. Business buyers generally make larger orders than consumer buyers.

Answers

The biggest difference between corporate and consumer purchasers is that business buyers frequently place larger purchases.

A business buyer of a firm could be an individual, a group of individuals, an institutional investor, a corporation operating in your industry or one closely related to it, or even a competitive company. Each of them has unique traits, objectives, working methods, and financial resources. Consumer buying behavior describes the steps consumers take before making a purchase of a commodity or service, both online and offline. This strategy could entail using search engines for research, taking part in online forums, and a number of other things. Consumer behavior is the result of a consumer's opinions, preferences, intentions, and judgments surrounding their market-based purchasing behavior.

To learn more about business buyers refer here:

https://brainly.com/question/28522094

#SPJ4

The GDP Deflator:
I. is used to calculate inflation rates.
II. is an alternative to the CPI.
III. is more accurate than the CPI.
A. Only I is true.
B. I and II are true.
C. I and III are true.

Answers

The statement that is correct concerning the GDP deflator is that it is used to calculate inflation rates. This statement is true. The correct option is A. Only I is true.

The Gross Domestic Product (GDP) deflator, like the Consumer Price Index (CPI), is a measure of price changes in an economy's production of goods and services. While the CPI measures the price changes of a basket of goods and services purchased by households, the GDP deflator reflects changes in prices of goods and services purchased by both households and the government, as well as investment goods purchased by firms. Gross Domestic Product (GDP) deflator is a price index used to calculate inflation rates. It is not an alternative to the CPI, and it is not more precise than the CPI, so the second and third statements are false.

Know more about GDP deflator here:

https://brainly.com/question/14842082

#SPJ11

The division of products into durable and nondurable goods helps to A) comply with NAICS guidelines. B) address environmental concerns. C) comply with ISO 9000 requirements. D) classify products for tax purposes. E) provide direction for marketing actions.

Answers

The division of products into durable and non-durable goods helps to provide direction for marketing actions. Option E is the correct answer.

Durable goods are items that last three years or more, such as automobiles and kitchen equipment. Non-durable products, on the other hand, are items that must be replaced after a year of use, such as food and cleaning supplies. Most companies categorize their products into two types: durable and non-durable.

Product classification into durable and non-durable items aids in marketing strategy development. Firms must employ different techniques to sell and market their products depending on the type of good. For example, firms must focus more on durability when marketing durable goods.

Therefore, option E is the correct answer.

Learn more about durable goods at

brainly.com/question/23965700

#SPJ4

if the adoption of a new product will reduce the sales of an existing product, then the project cash flows should: group of answer choices reflect only the sales of the new product include only the reduction of existing products amount be reduced by the cash that would have been generated by the reduction in existing products be adjusted upward by the reduction of existing products amount

Answers

If the adoption of a new product will reduce the sales of an existing product, then the project cash flows should  be reduced by the cash that would have been generated by the reduction in existing products.

Hence, correct answer is B.

Sales?

A sale is a deal that involves exchanging products or services for a certain sum of money. In other terms, a sale is any action that includes giving the buyer possession of a thing or commodity in return for money.

Marketing definition of sales?

Sales include the transfer of a product from the maker to the buyer in return for cash. Marketing is the process of marketing a product and determining the needs of the target market.

To know more about Sales visit:

https://brainly.com/question/29857652

#SPJ1

in a perfectly competitive market, the current price is $0.50 per kilogram. if a producer sells 10,000 kilograms at this price, the amount that the producer could have sold for $0.55 per kilogram is closest to:

Answers

In a perfectly competitive market, the current price is $0.50 per kilogram. If a producer sells 10,000 kilograms at this price, the amount that the producer could have sold for $0.55 per kilogram is closest to $5,500.

A perfectly competitive market is an environment in which there are several manufacturers, and the market is wide open, meaning that they all compete for the same customers. As a result, the cost is typically fixed, with no firm having any significant power to influence the price.

To calculate the amount that the producer could have sold for $0.55 per kilogram, follow these steps:                Calculate the producer's revenue at $0.50 per kilogram, given that: Revenue = Price × Quantity sold Revenue=$0.50×10,000 =$5,000

Determine the total amount of kilograms that the producer could have sold for $0.55. Total kilograms that could have been sold=$5,000/$0.55 =9,090.909.

Calculate the amount the producer could have sold at $0.55 per kilogram ,i.e., Amount = $0.55 × 9,090.909 = $5,000 Therefore, the amount that the producer could have sold for $0.55 per kilogram is closest to $5,500.

To know more about perfectly competitive , refer here

https://brainly.com/question/13961518#

#SPJ11

camille noah is investing $10,000 in an account paying 4.8% apr for five years. what is the interest on interest if interest is compounded quarterly? (round to the nearest dollar.) group of answer choices

Answers

The interest earned by Camille Noah is d) $2,855.55, and the interest on interest is $855.55

The interest on interest earned by Camille Noah can be calculated using the formula:

A = P(1 + r/n)^(n*t)

Where:

A = the total amount including principal and interest

P = the principal amount

r = the annual interest rate (as a decimal)

n = the number of times the interest is compounded per year

t = the number of years

Plugging in the given values, we get:

A = 10,000(1 + 0.048/4)^(4*5)

A = 10,000(1 + 0.012)^20

A = 10,000(1.012)^20

A = 12,855.55

Therefore, the interest earned by Camille Noah is $2,855.55, and the interest on interest is $855.55 (the difference between the total amount earned and the original principal). Rounded to the nearest dollar, the interest on interest is $856.

For more questions like Interest click the link below:

https://brainly.com/question/13324776

#SPJ11

Complete question:

Camille Noah is investing $10,000 in an account paying 4.8% APR for five years. What is the interest on interest if interest is compounded quarterly? (Round to the nearest dollar.) Group of answer choices $2,400 $242 $294 $2,855

true or false, it is important for team members to have different ideas and opinions and to express them to each other.

Answers

It is a true statement that it is important for team members to have different ideas and opinions and to express them to each other.

Why should team members have different ideas and opinions?

Having a diverse range of opinions within teams is critical for problem solving, as thinking from diverse groups of employees from diverse backgrounds can reduce risks by 30% and improve innovation by 20%.

When handled correctly, disagreements can help you learn more about your colleagues and better understand them. While opposing viewpoints can be unsettling, if you know how to debate civilly, nothing bad is likely to happen.

Read more about ideas

brainly.com/question/1914190

#SPJ1

lumeris inc., an automobile manufacturer, has an inflexible work schedule and requires its workers to work nine hours a day and six days a week. its laborers do not have adequate skills to perform their job efficiently. the inflexible work schedule and inadequate labor skills are examples of . question 22 options: physical constraints nonphysical constraints bottleneck activities work orders

Answers

The inflexible work schedule and inadequate labor skills at Lumeris Inc. are examples of b. nonphysical constraints.

Nonphysical constraints refer to limitations that are not related to physical or tangible aspects of a production process. They often involve managerial, organizational, or human factors that can affect the efficiency and productivity of a system. In the case of Lumeris Inc., the inflexible work schedule of nine hours a day and six days a week can lead to worker fatigue and dissatisfaction, reducing overall productivity and efficiency.

This type of constraint is nonphysical because it is related to the management and organization of the workforce, rather than the physical capacity or equipment of the production process. Similarly, inadequate labor skills also fall under nonphysical constraints. This is because they are related to the human factor – the workers' abilities to perform their tasks efficiently. When employees lack the necessary skills or training, it can result in decreased productivity, errors, and slower output. This can ultimately limit the performance of the company, even if there are no issues with the physical aspects of production, such as machinery or equipment.

In summary, nonphysical constraints are limitations that stem from factors other than tangible or physical elements of a system. In the case of Lumeris Inc., both their inflexible work schedule and inadequate labor skills are examples of nonphysical constraints that can negatively impact the efficiency and productivity of the company. Therefore, the correct option is b.

The question was incomplete, Find the full content below:

Lumeris Inc., an automobile manufacturer, has an inflexible work schedule and requires its workers to work nine hours a day and six days a week. Its laborers do not have adequate skills to perform their job efficiently. The inflexible work schedule and inadequate labor skills are examples of ___.

a. physical constraints

b. nonphysical constraints

c. bottleneck activities

d. work order

Know more about Nonphysical constraints here:

https://brainly.com/question/19512953

#SPJ11

4. What does the following formula illustrate? MUx/Px = MUY/Py
A)If a consumer likes Good X better than Y, than the price of X is of no concern.
B)If a consumer likes Product X better than Product Y, he should only buy as much X as possible and zero units of Y under all circumstances.
C)It reflects the ideal combination of two goods that a consumer should purchase relative to the price of those two goods.
D)Nothing - it's a bunch of mishmash meant to confuse me!

Answers

The formula [tex]MUx/Px = MUY/Py[/tex] helps us under the concept of marginal utility. It reflects the ideal combination of two goods that a consumer should purchase relative to the price of those two goods.

What is marginal utility?

The concept of marginal utility refers to the additional satisfaction or benefit gained by a consumer from consuming one more unit of a good or service.

In the case of the formula [tex]MUx/Px = MUY/Py[/tex], where

MUx = the marginal utility of good X, Px = the price of good X.MUY = the marginal utility of good Y, andPy = the price of good Y.

Overall, from a conservative standpoint, it reflects the ideal combination of two goods that a consumer should purchase relative to the price of those two goods.

You can learn more about marginal utility here https://brainly.com/question/14797444

#SPJ1

under the investment advisers act of 1940, all of the following are requirements for a family office to be excluded from the definition of an investment adviser except: a the family office must only provide investment advice to clients who are part of that family b the family office must be wholly owned by family clients and exclusively controlled by family members or entities c the family office cannot hold itself out as an investment adviser d the family office must have less than $100 million of assets under management

Answers

A family office is excluded from the definition of an investment adviser under the Investment Advisers Act of 1940 if it meets the following criteria: the family office must only provide investment advice to clients who are part of that family.

The family office must be wholly owned by family clients and exclusively controlled by family members or entities; and the family office must have less than $100 million of assets under management.

The exception to these criteria is that the family office cannot hold itself out as an investment adviser. In other words, the family office cannot advertise or present itself as an investment adviser in order to attract new clients.

To know more about investment click on below link:

https://brainly.com/question/15105766#

#SPJ11

Which of tenets of the "The Eller Way" advances the principle of "Do the right thing 100 percent of the time"?

Answers

The Eller Way is a philosophy developed by the University of Arizona’s Eller College of Management, which emphasizes ethical conduct, leadership, collaboration, innovation, social responsibility, and business education.

The principle of "Do the right thing 100 per cent of the time" advances the tenet of "integrity" in The Eller Way. Integrity is a fundamental aspect of ethical behaviour and professional conduct that promotes honesty, responsibility, trust, and respect in business dealings, academic pursuits, and personal relationships.

The Eller Way’s integrity tenet requires individuals to uphold the highest standards of ethical behaviour and moral values by following legal and ethical guidelines, being transparent and honest in communications, showing respect and consideration for others, and taking responsibility for one’s actions and decisions.

In summary, the principle of "Do the right thing 100 per cent of the time" aligns with The Eller Way’s integrity tenet, which promotes ethical behaviour and professional conduct by emphasizing honesty, responsibility, trust, and respect.

For more such questions on Management

https://brainly.com/question/13188207

#SPJ11

The tenet of "The Eller Way" that advances the principle of "Do the right thing 100 percent of the time" is: "Act with Integrity".

Explanation:

This tenet focuses on doing the right thing all the time, even when it is inconvenient, difficult, or unpopular. It encourages the use of honesty, transparency, and ethical behavior in all interactions, as well as taking responsibility for one's own actions and decisions.

In addition to "Act with Integrity," "The Eller Way" has three other tenets.

These are: "Collaborate and Create Value," "Excel with Relevance," and "Lead with Compassion." These tenets aim to promote teamwork, innovation, continuous learning, and empathy, which are essential skills for success in the business world.

To learn more about tenet, refer below:

https://brainly.com/question/30791477

#SPJ11

. on the consolidated financial statements for 2020, what amount should have been shown for consolidated dividends?

Answers

The amount of consolidated dividends shown on the consolidated financial statements for 2020 should be the total dividends declared by the parent company and its subsidiaries.

This amount is calculated by summing the dividend payments declared by each company in the group. For example, if the parent company declared a dividend of $100 and the subsidiary declared a dividend of $50, then the total consolidated dividend would be $150.

When calculating consolidated dividends, only the amounts declared by the parent company and its subsidiaries should be considered. Other items, such as related income taxes or capital transactions, should not be included in the consolidated dividend calculation.

In addition, any intercompany transactions or dividend payments to related parties should be excluded. The consolidated dividend should be reported in the parent company’s financial statements and should be disclosed separately in the notes to the financial statements.

To know more about financial statements  click on below link:

https://brainly.com/question/14951563#

#SPJ11

the loan amount is $410,000 and the loan to value ratio is 75%. what is the purchase price of the property?

Answers

The purchase price of the property is $546,666.67.

The loan amount is $410,000 and the loan to value ratio is 75%. To determine the purchase price of the property, we can use the following formula:

Loan Amount = Purchase Price x Loan to Value Ratio

Rearranging the formula to solve for the purchase price, we get:

Purchase Price = Loan Amount / Loan to Value Ratio.

Substituting the given values, we get: Purchase Price = $410,000 / 0.75Purchase Price = $546,666.67

Therefore, the purchase price of the property is $546,666.67.

To learn more about loan, refer below:

https://brainly.com/question/11794123

#SPJ11

gugenheim, incorporated, has a bond outstanding with a coupon rate of 7.6 percent and annual payments. the yield to maturity is 8.8 percent and the bond matures in 18 years. what is the market price if the bond has a par value of $2,000?

Answers

The market price of the Gugenheim, Inc. bond is approximately $1,450.

To calculate the market price of the bond, we need to use the present value formula, which calculates the current value of future cash flows. The coupon payments and the par value of the bond represent the future cash flows.

First, we need to calculate the annual coupon payment by multiplying the coupon rate of 7.6% by the par value of $2,000, which gives us $152 in annual coupon payments.

Next, we need to calculate the present value of the bond's coupon payments and par value using the yield to maturity of 8.8% and the 18-year maturity. We can use a financial calculator or a spreadsheet program to do this calculation. The present value of the bond's cash flows is approximately $1,449.28.

Therefore, the market price of the Gugenheim, Inc. bond is approximately $1,450, which is the sum of the present value of the bond's cash flows.

To know more about Guggenheim, Inc. bond, refer here:

https://brainly.com/question/17284650#

#SPJ11

question content areain 2022, joanne invested $90,000 for a 20% interest in a limited liability company (llc) in which she is a material participant. the llc reported losses of $340,000 in 2022 and $180,000 in 2023. joanne's share of the llc's losses was $68,000 in 2022 and $36,000 in 2023. how much of these losses can joanne deduct?

Answers

Joanne's losses are not subject to the passive activity loss rules in either year because she is a material participant in the activity. However, the at-risk rules limit her total losses to $90,000 ($68,000 in 2022 and $36,000 in 2023).

An LLC is a type of business structure that provides all the security of a corporation because it allows you to deduct any business profits and losses from your personal income tax return.

Before a business loss can be claimed and fully utilized on the individual owner's tax return, it must first pass through a number of limitations. The most significant obstacle of all is probably waiting for a loss to be allocated correctly in accordance with the terms of the LLC operating agreement. It can be difficult to prepare a proper allocation of an LLC's operating loss.

The operating agreement, which represents the ownership contract between the LLC members, is the first document to be signed. The rights of the members with regard to profit and loss allocations, cash distributions, and other rights should be fully and explicitly stated in this contract.

Learn more about income tax return at:

brainly.com/question/16180101

#SPJ4

the point at which average total cost is minimized is known as

Answers

The point at which average total cost is minimized is known as the "minimum efficient scale."

The minimum efficient scale is the level of production at which long-run average cost is at its minimum. MES refers to the lowest point on a firm's long-run average cost curve at which it can produce its product at minimum unit cost. At the MES, the company has economies of scale; beyond the MES, the company has diseconomies of scale. The MES is often compared to the minimum efficient size (MES), which refers to the smallest efficient size of a company.

The MES is used in economic theory to describe the most efficient size of a firm in the long term. Benefits of the MES include: Cost advantages: A firm's ability to produce at a lower unit cost as a result of lower costs of inputs, such as labor and capital, is referred to as economies of scale. Risk mitigation: As a result of MES, companies can lessen the negative effects of economic downturns on their earnings.

Reduced competition: Since only the largest and most successful companies can achieve an MES, the MES serves as a barrier to entry for new entrants into the industry.

To know more about average total cost, refer here:

https://brainly.com/question/13950634#

#SPJ11

what is the main difference between a defined benefit (db) pension and a defined contribution (dc) pension?

Answers

The main difference between a defined benefit (DB) pension and a defined contribution (DC) pension is that a DB pension provides a guaranteed retirement income based on a formula, while a DC pension provides a retirement income based on contributions and investment earnings.

What is a defined benefit pension plan?

A defined benefit (DB) plan is a type of pension plan that promises a specific benefit amount to employees when they retire, which is generally based on a formula that considers an employee's years of service and final average pay. Employers fund DB pension plans and are responsible for ensuring that there are enough assets in the plan to pay promised benefits.

What is a defined contribution pension plan?

A defined contribution (DC) plan is a type of retirement plan that allows employees to contribute a portion of their salary into an account that grows tax-free until retirement. Employers may also contribute to the employee's account in the form of matching contributions or profit-sharing contributions.

The account balance at retirement is determined by the contributions made and the investment returns earned on those contributions. The employee is responsible for managing the investments in the account and bears the investment risk.

The employee also has the flexibility to choose when to retire and how to take distributions from the account.

To learn more about defined contribution, refer below:

https://brainly.com/question/12334165#

#SPJ11

nowell inc. had the following stock issued and outstanding at january 1, year 2: 150,000 shares of no-par common stock. 30,000 shares of $50 par, 4 percent, cumulative preferred stock. (dividends are in arrears for one year, year 1.) on march 8, year 2, nowell declared a $175,000 cash dividend to be paid march 31 to shareholders of record on march 20. required what amount of dividends will be paid to the preferred shareholders versus the common shareholders?

Answers

The amount of dividends that will be paid to the preferred shareholders versus the common shareholders are $60,000 and $115,000, respectively.

On March 8, Year 2, Nowell Inc. declared a $175,000 cash dividend to be paid on March 31 to shareholders of record on March 20. The amount of dividends that will be paid to the preferred shareholders versus the common shareholders can be calculated as follows:

Amount of dividends paid to preferred shareholders = Par value of preferred stock * Number of preferred shares outstanding * Preferred dividend rate= $50 * 30,000 * 4% = $60,000

Amount of dividends paid to common shareholders = Total dividends - Amount of dividends paid to preferred shareholders= $175,000 - $60,000 = $115,000.

For more about shareholders:

https://brainly.com/question/29803660

#SPJ11

the mismatch between the high level of tech skills demanded by employers and the low level of tech skills held by employees is known as

Answers

The mismatch between the high level of tech skills demanded by employers and the low level of tech skills held by employees is known as Skill Gap. This is due to shortage of skilled workers.

What is Skill Gap?

The term "skills gap" is used to describe a gap between the skills an individual has and the skills an employer requires. In general, there are two main forms of skill gaps. In terms of the job market, a skill gap is an assessment of the differences between the job requirements of an employer and the capabilities of the workforce.

Skill gaps may also exist at a societal level, reflecting a country's comparative disadvantage in high-tech industries, for example. To put it another way, a skills gap exists when there is a shortage of skilled workers in a specific region, industry, or economy. A skills gap occurs when a firm requires a specific set of skills and knowledge from its employees but is unable to locate individuals with those abilities. In this instance, the market price for labor will rise to reflect the increased demand for workers with those abilities.

Learn more about Skill gap here:

https://brainly.com/question/16826629

#SPJ11

simple cvp analysis can be relied on for changes in volume outside the relevant range. true false question. true false

Answers

Tthe simple CVP analysis cannot be used to make predictions about profits and losses beyond the relevant range. True is the correct answer.

Simple CVP (Cost Volume Profit) analysis is based on the following assumptions: The selling price is constant, variable expenses are constant per unit, and total fixed costs are constant within the relevant range.

What is the relevant range in CVP analysis?

The relevant range refers to a range of activity levels over which total fixed costs and per-unit variable costs remain constant. A linear cost-volume-profit (CVP) model is used to analyze the relationship between these three factors, and it is useful for predicting a company's profit or loss based on changes in sales volume. In other words, the relevant range is the activity level range where the linear assumptions of the model are valid. Outside the relevant range, however, these assumptions may not hold true.

As a result, the simple CVP analysis cannot be used to make predictions about profits and losses beyond the relevant range. True is the correct answer. False is not the correct answer.

For more such question on CVP

https://brainly.com/question/23894490

#SPJ11

which of the following counts toward changes in the current gdp? group of answer choices the government builds a new highway. you find $10 on the sidewalk. you fix your own sink. you purchase a used stereo from a friend. none of these answers is correct.\

Answers

The government builds a new highway counts towards changes in the current GDP.

What's GDP

The Gross Domestic Product (GDP) is the sum of all goods and services produced within a country in a given year. GDP helps to measure economic growth, prosperity and economic well-being.

Any production activities that take place within the country’s borders are included in GDP. This can be determined by summing up the expenditures of different sectors or from the output side of the economy.

GDP can be calculated as follows:

GDP= C+I+G+(X-M)

Where

C = Personal consumption expenditures

I = Gross investment

G = Government consumption expenditures and gross investment

X = Exports

M = Imports

Therefore, the only option that counts towards changes in the current GDP is the government builds a new highway.

Learn more about GDP at

https://brainly.com/question/25996779

#SPJ11

sam is applying for a single year life insurance policy worth $40,950.00 . if the actuarial tables determine that she will survive the next year with probability 0.993 , what is her expected value for the life insurance policy if the premium is $371.00 ?

Answers

The expected value of Sam's life insurance policy is $367.83. This is calculated by multiplying the probability of survival (0.993) by the policy's face value ($40,950.00) and then subtracting the premium ($371.00).

The expected value is the amount a person should expect to receive from the policy if they were to purchase it. It is an estimate of the average return from the policy over a given period of time.

In this case, the expected value is slightly less than the premium due to the fact that Sam has a higher than average chance of survival. Therefore, the insurer has priced the policy to reflect this increased likelihood of survival.

Know more about insurance policy here

https://brainly.com/question/17479291#

#SPJ11

The choice of when and how to source capital globally is usually aided early on by the advice of:
A) an investment banker.
B) your stock broker.
C) a commercial banker.
D) an underwriter.

Answers

The choice of when and how to source capital globally is usually aided early on by the advice of an investment banker. The correct option is A) an investment banker.

An investment banker is a person who is responsible for giving companies, governments, and other large entities advice and support in regard to various financial matters, such as fundraising, debt structuring, mergers and acquisitions, and stock offerings.

An investment banker can also help companies find potential investors who may be interested in buying a stake in their company or investing money in their business.

The role of investment bankers is often critical in helping companies raise capital, expand their operations, and achieve their strategic goals.

Hence, the choice of when and how to source capital globally is usually aided early on by the advice of an investment banker.

The choice of when and how to source capital globally is usually aided early on by the advice of an investment banker.

The correct option is A) an investment banker.

To learn more about “investment banker” refer to the https://brainly.com/question/12301548

#SPJ11

esfandairi enterprises is considering a new three-year expansion project that requires an initial fixed asset investment of $2,710,000. the fixed asset will be depreciated straight-line to zero over its three-year tax life. the project is estimated to generate $3,370,000 in annual sales, with costs of $2,190,000. the project requires an initial investment in net working capital of $190,000, and the fixed asset will have a market value of $225,000 at the end of the project. assume that the tax rate is 24 percent and the required return on the project is 12 percent. what are the net cash flows of the project each year?

Answers

The net cash flows of the project for year 1 is $1,153,200, year 2 is $1,153,200, and year 3 is $1,378,200.

It is provided that Esfindari Enterprises is evaluating a new 3-year project that needs an initial fixed asset investment of $2,710,000. The fixed asset will be depreciated straight-line to zero over its three-year tax life. The project is estimated to produce $3,370,000 in yearly sales, with expenses of $2,190,000. The project needs an initial investment in net working capital of $190,000, and the fixed asset will have a market value of $225,000 at the end of the project. Assume that the tax rate is 24 percent and the required return on the project is 12 percent.

The net cash flows of the project each year are:

Fixed asset investment = $2,710,000, Working capital investment = $190,000

Working capital will be released at the end of the project, implying a cash inflow of $190,000.

The tax savings from depreciation are:

$2,710,000/3 years = $903,333 yearly depreciation

Tax savings = $903,333 × 0.24 = $216,800 yearly.

There are no tax consequences for the working capital investment or the disposal of the fixed asset.

Most of the annual cash flows will be produced by the project's revenues: $3,370,000 – $2,190,000 = $1,180,000 yearly operating income ($3,370,000 × 0.35. )When the annual cash flows are summed, they provide the following net cash flow for the project over each of the three years: $717,200, $1,496,800, $1,331,200

Year 1: Total net cash inflow=$190,000+$1,180,000-$216,800=$1,153,200

Year 2: Total net cash inflow=$1,180,000+$190,000-$216,800=$1,153,200

Year 3: Total net cash inflow=$1,180,000+$190,000+$225,000-$216,800=$1,378,200

Hence, the net cash flows of the project each year are $1,153,200, $1,153,200, and $1,378,200 for years one, two, and three, respectively.

Learn more about Net cash flows:

https://brainly.com/question/25716101

#SPJ11

Other Questions
the alpha level for a hypothesis test defines the critical region the alpha level for a hypothesis test defines the critical region true false Question 3 a) What is the theoretical probability of rolling a sum of 8? b) What is your experimental probability of rolling a sum of 8? c) What are the odds of rolling a sum of 8? the unadjusted trial balance columns of a company's work sheet shows the store supplies account with a balance of $580. the adjustments columns shows a credit of $325 for supplies used during the period. the amount shown as store supplies in the balance sheet columns of the work sheet is: What is an angle that is adjacent to DHC? which of the following is an internal control procedure used to safeguard a company's assets? multiple choice all of these answer choices are correct segregation of duties depositing cash receipts in a bank on a timely basis preparing a bank reconciliation what is the probability that at least two of the six members of a family are not born in the fall? assume that all seasons have the same probability of containing the birthday of a person selected randomly. willis middle school participates in a school-wide positive behavior supports program. several students have been identified with repeated office referrals and suspensions. these students would fall into which level of the three-tiered model of intervention? Write a program that will read a file (data.txt). The file contains integer values. Theprogram will read the file and create a list. (Python) If triangle ABC has points A(2, -4) B(-3, 1) C(-2, -6) and you perform the following transformations, where will B' be?Reflection over the y-axis, rotation 90 clockwise, and translation (x + 2, y - 1)B'( , ) One more than two-thirds of a number is no less than 25 During a video about the Mayan civilization, you learn about a bright blue paint pigment that has not faded over time. The chemical composition of this paint pigment has allowed it to withstand not only natural elements, such as sun and rain, but also chemical solvents and acids. What paint did you MOST likely hear about? A. Maya blue B. stucco C. stela D. hieroglyphs you are attempting to interview a 20-year-old patient who brought her two young children with her to the office today she is a single mother who is pregnant with her third child and receives public assistance. how will this response impact your ability to be empathetic? in the context of the net promoter score (nps), which of the following is a difference between promoters and detractors? question 29 options: unlike promoters, detractors are customers who are associated with scores of 7 or 8. unlike promoters, detractors are satisfied customers who may switch to competitors. unlike promoters, detractors defect at higher rates. unlike promoters, detractors are less price sensitive. if you were asked to dissolve a solid into an aqueous solution, how could you speed this process up? how could you slow it down? listed below are a number of possible ways to alter the rate of this process. place them in the proper category. if you need help, think about putting sugar in your tea. items: add the solute in large chunks. add the solute slowly. increase the atmospheric pressure. stir or agitate the solution. if a restriction enzyme that recognizes ggcat and cuts between the two guanine residues is mixed with dna that has the sequence ccgattataatcccgcggcatattagggcgg, how many pieces would the resulting product be? which of the following would most directly interfere with sperm production? which of the following would most directly interfere with sperm production? use of synthetic steroids (testosterone) low sperm count interruption of sustentocytes' production of abp ingestion of a substance that mimicked inhibin How did US and Soviet nuclear arsenals compare? Use the equation in the example to find the number ofcups of water you need if you have 12 cups of flour. when carbonyl compounds are reduced with a reagent such as lialh4 or nabh4 and a new stereogenic center is formed, what will the composition of the product mixture be? 7The United States receives more immigrants than any other nation in the world. However, many countries, like Saudi Arabia and Australia, have a greater percentage of their population made up of immigrants. What does this information reveal about these countries? A. They have smaller populations than that of the United States. B. Their life expectancy is less than in the United States. C. They have more lenient immigration policies than those in the United States. D. They encourage immigrants to move there more than the United States does.