A fixed pattern of long and short notes that is repeated or varied is known as a. a cantus firmus. b. a rhythmic mode. c. a melisma. d. organum.

Answers

Answer 1

A cantus firmus (Latin for "fixed song") is a pre-existing melody used as the basis of a new composition. So option a is correct.

It is most commonly found in the form of a long and slow-moving melody, which is then repeated or varied by the composer. The cantus firmus was a popular form of composition in the Middle Ages and Renaissance eras, used by composers such as Josquin des Prez, Palestrina, and Orlando di Lasso.

A rhythmic mode is a pre-existing pattern of strong and weak beats used as the basis of a new composition. It is a more varied form of composition than the cantus firmus, as it contains not only long and slow-moving notes, but also fast and light notes. The rhythmic mode is found in music from many different cultures, such as African, Indian, and Latin American. Composers such as Bach, Beethoven, and Mozart used rhythmic modes in their compositions.

A melisma is a type of vocal ornamentation in which several notes are sung on the same syllable. It is a popular form of singing in many musical styles, including jazz, gospel, and classical. Melismatic singing is often used to express emotion or add color to a song. Composers such as Handel and Vivaldi used melismatic singing in their compositions.

Learn more about cantus firmus at : https://brainly.com/question/11182556

#SPJ4


Related Questions

What is the best example of a Mendelian trait in humans?

Answers

The best example of a Mendelian trait in humans is phenylketonuria. This illness is an illustration of a Mendelian trait since it is passed down from parents to children when both parents have heterozygous (Aa) and homozygous (Aa) circumstances.

Mendelian qualities are determined by all of Mendel's postulated Laws of Inheritance and are traits that are transferred from parents to children through dominant and recessive alleles of a gene. The lack of an enzyme that turns the amino acid phenylalanine into tyrosine is the root cause of the autosomal recessive inherited disorder. As a result, the amino acid builds up and is converted into the toxic form of phenyl pyruvic acid, which builds up in the brain of the person and causes r-e-t-a-r-d-a-t-i-o-n.

To know more about Mendelian traits please visit

https://brainly.com/question/29754443

#SPJ4

Explain how the structure and function of the smooth muscle, skeletal muscle and cardiac muscle is required for its function in the body.

Answers

Answer:

Cardiac and skeletal muscle are both striated in appearance, while smooth muscle is not. Both cardiac and smooth muscle are involuntary while skeletal muscle is voluntary. ... Cardiac muscle is also an involuntary muscle but is more akin in structure to skeletal muscle, and is found only in the heart.

what is binomial nomenclature. please help ASAP​

Answers

binomial nomenclature definition

Explanation:

the system of nomenclature in which two terms are used to denote a species of living organism, the first one indicating the genus and the second the specific epithet.

Answer:

the system of nomenclature in which two terms are used to denote a species of living organism, the first one indicating the genus and the second the specific epithet.

What happens after point A in regard to the population and resources available at that point in time?

Answers

At Point A, population and resources are consistent with each other. This meant at the time, that populace had access to sufficient resources.

Natural resources are anything that can be obtained from the environment for human needs. The more the population increases, the more natural resources are used to meet needs.

For example, food, clean water, clean air, and other needs. If the population increases, various problems will arise, for example, traffic flow density which causes air pollution, many agricultural lands being used as residential areas resulting in slums, and finally clean water becomes a problem. The more the population, the fewer natural resources will be eaten.

The complete question is seen in the picture

Learn more about the population and resources at https://brainly.com/question/24067944

#SPJ4

8. In a deletion mutation a base my be
C. Moved
A. Left out
B. added in

Answers

Answer:

LEFT OUT

hope it help

HELP PLEASE!!!! growing on
With secondary
Primary succession begins with plants like
succession is already present.

lichens...bare rock...soil

moss...soil...a habitat

dandelions...bare rock...a habitat

palm trees...soil...an animal

Answers

Answer: Is A

Explanation:

Lichens break down rock from there the soil start to create life i don't how to explain it

Which blood type can be donated to the largest percentage of individuals?

Answers

Answer:

Type O+

Explanation:

What happens to the light when you look at a green object?

Answers

When you look at a green object, the object reflects green light and absorbs other colors of the visible spectrum. The green light is then transmitted to your eye, where it is focused by the lens onto the retina.

The retina contains specialized cells called rods and cones that are sensitive to different wavelengths of light. The cones in the retina are responsible for color vision and are most sensitive to different colors in the visible spectrum, and when the green light reaches the cones, it triggers a neural signal that is sent to the brain, where it is interpreted as the color green. The absorbed light colors are not reflected and are green absorbed by the object, they are not transmitted to green the eye, so they are not perceived by the observer.

Learn more about light here:

https://brainly.com/question/8181719

#SPJ4

How does folding dough help it to rise

Answers

folding dough increases the air trapped between the layers which cause it to rise

How can a cup of water decrease in temperature? please answer my question in a scientific method, the questions will be below.

Step 1: Observation

Step 2: Research:

Step 3: Hypothesis:

Step 4: Experiment – explain the experiment that you would perform

Step 4a- The control variable

Step 4b- The dependent variable

Step 4c- The independent variable

Step 5- What do you predict the conclusion to be?

Answers

The first step for this experiment is observation where it is found that a cup of water decreases in temperature. The rest of the steps are described in the explanation part.

What is a Scientific method?

A scientific method may be characterized as the process of objectively establishing facts through testing and experimentation. The basic process involves making an observation, forming a hypothesis, making a prediction, conducting an experiment, and finally analyzing the results.

The second step is research in which a cup of water is placed at different temperatures where it can easily change its state from liquid to solid. The hypothesis governs that the amount of water in a cup may lower or decreases when it is exposed to several temperatures.

The experiment is performed on the basis of certain evidence and assumptions in order to predict some conclusion. The control variable is the influence of temperature. The dependent variable is the amount of water and the independent variable is the exposure to temperature.

Therefore, it is concluded that a cup of water decreases in temperature.

To learn more about the Scientific method, refer to the link:

https://brainly.com/question/497944

#SPJ1

List all the possible genotypes of the offspring from your Punnett

square in question 4. Next to each genotype write the corresponding

phenotype---short stems or tall stems.

Answers

we see that there are three possible genotypes that could result from this crossing: AA, Aa, aa. The genotypes AA and Aa will result in the yellow pea phenotype because A is dominant. Only aa will produce the green pea phenotype.

A Punnett square is a graph that makes it simple to ascertain the anticipated proportion of various genotypes in children of two parents. Figure below illustrates a Punnett square for pea plants. In this instance, flowercolor is heterozygous for both parents (Bb). The top of the graph represents the gametes produced by the male parent, while the sides represent the gametes produced by the female parent. By correctly filling in the Punnett square's cells, we may identify the various possible allele combinations in their progeny (alleles).

To learn more about Punnett square please visit here:

https://brainly.com/question/27984422

#SPJ4

How can katey and amanda's amino acid sequence be the same and yet they may have a differences in their DNA?

Answers

Answer: Two people can have different DNA sequences but these sequences can code for the same amino acids due to the redundancy of the genetic code in which two different codons can code for the same amino acid.

Explanation:

The genome of an organism is found in a molecule called DNA (deoxyribonucleic acid). The main function of this DNA molecule is the long-term storage of information to build other components of cells, such as proteins and RNA molecules (ribonucleic acid); and the portion of the genome that codes for a protein or RNA is known as a gene. These protein-coding genes are composed of trinucleotide units called codons, each of which codes for an amino acid. For a protein whose sequence is encoded in the nucleotides of DNA to be synthesized, that DNA molecule must first be transcribed into a molecule called messenger RNA, and this molecule is used for a process called translation or protein synthesis. The sequence of the genetic material is composed of four distinct nitrogenous bases, which are represented by letters in the genetic code:

Adenine (A)Thymine (T)Guanine (G) Cytosine (C)Uracil (U) instead of T in RNA

The genetic code is the set of rules that defines how a sequence of nucleotides in RNA is translated into a sequence of amino acids in a protein. This code is common to all living things, which shows that it has had a unique origin and is universal. So, the code defines the relationship between each sequence of three nucleotides (codon) and each amino acid.  The number of possible codons is 64, of which 61 code for amino acids (one of them being the start codon, AUG) and the remaining three are stop sites (UAA, UAG, UGA). The codon sequence determines the amino acid sequence in a particular protein, which will have a specific structure and function.

However, the genetic code has redundancy but no ambiguity. For example, two different codon can code for the same amino acid, and the differences between codons encoding the same amino acid have differences in the third position. This is explained by the wobble effect, where the same anticodon (present in the transfer RNA that loads with the amino acid and interacts with the codon in the messenger RNA) can establish interaction with different codons, which differ in their third base. This is why, in general, tolerance to change at this position is greater than at the first and second positions, and therefore tends to be less represented in the case of variations that result in pathologies.

Thus, two people can have different DNA sequences but these sequences can code for the same amino acids due to the redundancy of the genetic code in which two different codons can code for the same amino acid.

What causes populations to lose genetic diversity due to chance?

Answers

Stochastic sampling error (i.e., genetic drift) causes populations to lose genetic diversity due to chance.

Genetic drift is a result of sampling error because individuals are randomly chosen when a population is sampled. A random selection is one in which each member of the population has an equal chance of being chosen.

The random change in allele frequencies caused by stochastic sampling of alleles from the previous generation is known as genetic drift (independent of demographic stochasticity).

The variety of various inherited features within a species is referred to as genetic diversity. There would be many people with a wide range of diverse traits in a species with significant genetic diversity. For a population to adapt to changing surroundings, genetic variety is essential.

To learn more about Genetic diversity :

https://brainly.com/question/14926046

#SPJ4

What is the probability that a baby born to a man and woman both carriers for the recessive albino gene will be an albino?

Answers

If both parents have the gene, their child has a 1 in 4 chance of having inheritance albinism and a 1 in 2 chance of having the gene. Although they do not have albinism, carriers can pass the gene on.

One type of inheritance pattern for a trait, sickness, or problem that is passed down through families is autosomal recessive characteristics. There must be two copies of a recessive trait or disease for it to manifest. The gene or characteristic will reside on a non-sex chromosome. As a trait requires two copies to develop, many people may unintentionally carry a disease. A recessive illness or characteristic may go unnoticed for a few of generations before manifesting as the phenotypic, according to evolutionary theory. Diseases that are autosomal recessive include albinism and cystic fibrosis.

To learn more about inheritance click on the given link: https://brainly.com/question/14930526

#SPJ4

While both the endocrine and nervous systems are involved with communication, they differ in their mechanisms. What is one difference between hormones of the endocrine system and neurotransmitters of the nervous system

Answers

Answer:

Hormones are released by the glands in the endocrine system and are transmitted into the bloodstream..while neurotransmitters are released by the presynaptic terminal in the synapse and are transmitted across the synaptic cleft....

I hope this helps

5. Kimberly draws the food web shown. A reduction in the population of which organism
would reduce the food sources available to all of the other organisms? (1 point)

Answers

Answer: Krill

Explanation:

Tha basis for energy of the animals is krill - so reduction in its population would influence all organisms.

Which of the following statements best explains differences between the finches?

A. Some finches were born with beaks that allowed them to have better access to different sources of food. These finches reproduced and passed on their genes.

B. The beaks of the finches changed so all of the finches could eat the same types of food.

C. The beaks of the finches changed as the species of finches migrated to the same island.

D. The beaks of the finches changed as the finches' body sizes changed.

Answers

Answer:

i think it's D I hope this helps :)

Answer:

D is the answer

Explanation:

Can soneone please explain enzymes in a clear and in an understandable way?

Answers

Enzymes are biological catalysts* and enzymes are also a protein

Catalysts* are a substance that can speed up reactions

Conventional CPR provides 15% of normal blood flow to the heart and blood flow to the brain is 25% of normal. The Res Q Pod is an impedance device that prevents unnecessary air from entering the chest during the compression phase of CPR. When air is prevented from rushing into the lungs as the chest wall recoils, the vacuum (negative pressure) in the thorax pulls more blood back to the heart, resulting in:

Answers

The Res Q POD ITD lowers intrathoracic stress at some point of the draw back segment of CPR with the aid of using selectively limiting pointless airflow into the chest.

This vacuum will increase preload, lowers intracranial stress (ICP), and improves blood go with the drift to the mind and crucial organs. Compress the ResQPUMP towards a clean difficult floor with about 50 kg of pressure, the use of the pressure gauge at the ResQPUMP as a guide. Observe for an growing gauge reading. 3. Pull up at the deal with with about 10 to fifteen kg of pressure, the use of the decompression pressure gauge as a guide. The CPR remarks gadgets permit to screen the best of resuscitation and tell the rescuer approximately the fundamental parameters of the guide chest compressions being performed, consisting of chest compression price and depth, and complete chest recoil.

To learn more about CPR check the link below:

https://brainly.com/question/3725035

#SPJ4

Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA

Answers

ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA edits the DNA of the first codon to AAA, so it changes to AAA CCG GGC GGC GAG AGC TTG CTA ATT GGC TTA TAA, so its complementary sequence is TTT GGC CCG CCG CTC TCG AAC.

What is DNA?

Every cell's DNA contains information that is transformed into brief, portable RNA messages during transcription.

The fact that DNA is in charge of the process known as the protein synthesis method by which cells produce proteins is another highly significant function of DNA.

Therefore, DNA dictates the structure and function of your proteins, every component of your body, including your fingernails, eyes, and many other things are comprised of proteins.

Learn more about DNA, here:

https://brainly.com/question/21992450

#SPJ1

A molecule that can be used as a molecular clock has a neutral mutation rate of one mutation per 40 million years. How many years ago did two species share a common ancestor if the molecules found in these two species differ by a total of eight mutations

Answers

The two species must have shared a common ancestor 320 million years ago, since the neutral mutation rate of the molecular clock is one mutation per 40 million years and the two species differ by a total of eight mutations.

A molecular clock is a tool used by scientists to estimate the time since two species have shared a common ancestor. This is done by measuring the number of genetic differences, or mutations, between the two species. The molecular clock is based on the assumption that the mutation rate is constant.

In this case, we know that the neutral mutation rate of the molecule being used as a molecular clock is one mutation per 40 million years. This means that for two species to have a difference of eight mutations, it must have been at least 320 million years ago that they shared a common ancestor.

To arrive at this conclusion, we can use the following formula:

Number of mutations × Neutral mutation rate = Time since common ancestor

In this case, 8 mutations × 40 million years = 320 million years. This means that two species must have shared a common ancestor at least 320 million years ago for them to have a difference of eight mutations.

The molecular clock can be a powerful tool for scientists to estimate the time since two species have shared a common ancestor. In this case, the neutral mutation rate of the molecule was known and used to calculate that two species must have shared a common ancestor at least 320 million years ago.

Learn more about molecular clock at : https://brainly.com/question/14352403

#SPJ4

What component allows semen to temporarily coagulate, preventing it from leaking back out of the female reproductive tract, once ejaculated

Answers

The protein-based compound called semenogelin is the main component that allows semen to temporarily coagulate and remain in the female reproductive tract after ejaculation.

This compound is produced primarily in the seminal vesicles, which are located in the male reproductive system. Semenogelin is composed of two major proteins, semenogelin I and semenogelin II. These two proteins combine to create a gel-like substance that helps semen to form a cohesive mass.

This mass helps to keep semen from leaking back out of the reproductive tract and helps to ensure that sperm are able to reach the egg for fertilization. The gel-like substance also helps to protect the sperm from the acidic environment of the female reproductive system. This coagulation process typically lasts for around 30 minutes before the semen begins to break down and is reabsorbed into the female reproductive tract.

To learn more about coagulate visit:

https://brainly.com/question/12077625

#SPJ4

What food chain is a snail?

Answers

Snails are the part of the grazing food chain where they belong to the category of primary consumers.

Food chain is a hierarchical series of energy transfer where one organism feeds upon the lower one to gain energy. There are two main types of food chains: grazing food chain and the detrital food chain. The grazing food chain starts with the autotrophs whereas the grazing food chain begins with the dead and decaying organic matter.

Consumers are the animals that depend on other organisms for their food and energy source. Consumers can be of three types: herbivores, carnivores and omnivores.

To know more about consumers, here

brainly.com/question/2676728

#SPJ4

Ue evidence from model to contruct an explanation about how carbon can form chain and ring tructure in biomolecule and how boimolecule are ued in cell procee

Answers

Biomolecules are used in cells to build cells and provide energy to cells.

Living organisms are built from the element carbon which has a mass of more than half the dry mass of their cells. Elemental carbon can form single bonds with hydrogen atoms, and double bonds with oxygen atoms or nitrogen atoms. The carbon atom is special because of its ability to form very stable bonds with other carbon atoms so that it can form very large molecules. Two carbon atoms can also be bonded together to form a double or triple bond.

Most biomolecules can be viewed as derivatives of carbonates, a group of compounds consisting only of the elements carbon and hydrogen, by replacing one or several hydrogen atoms with certain functional groups, resulting in various groups of carbon compounds with distinctive properties.

Learn more about biomolecule at https://brainly.com/question/10904629

#SPJ4

_________ refers to a pea plant that is either homozygous dominant or homozygous recessive for a particular trait.

Answers

Answer:

A purebred.

Explanation:

A purebred is an animal or plant that carries two identical alleles for a particular gene or trait. This means that if the pea plant is homozygous dominant (has two of the same dominant alleles), or homozygous recessive (has two of the same recessive alleles), it is considered a purebred. A purebred always expresses only one form of the trait.

Which of the following is an example of one stage in ecological succession?
A. A tree falls over in a forest.
B. Weeds grow in a garden.
C. Fish swim in a pond.
D. A bird lays eggs in a nest.

Answers

The best answer for this question is C.

In community ecology we discussed the four main types of Interspecific Interactions. Select the correct answer(s): Group of answer choices Two possible outcomes of competition are resource partitioning and extinction Some bacteria use specialized metabolites (e.g., antibiotics, siderophores) to compete more effectively. Predation has a small impact on microbial community composition in oceans The production/release of antagonistic factors (e.g., lytic compound) to impede competitors is an example of exploitation competition

Answers

Answer:

Two possible outcomes of competition are resource partitioning and extinction.

Explanation:

Community ecology is the association of two or more population of different species that occupy the same geographical area within the same time and thus the term studies the interaction that takes place between the species in temporal and spatial scale.  

Substance Y is not present in the urine; however, it was originally filtered through the glomerulus. How is this possible

Answers

Substance Y is not present in the urine; however, it was originally filtered through the glomerulus it was reabsorbed in the proximal tubule.

As blood flows into every nephron, it enters a cluster of tiny blood vessel, the glomerulus. The skinny partitions of the glomerulus permit smaller molecules, wastes, and fluid—often water, into the tubule. Larger molecules, together with proteins and blood cells, live withinside the blood vessel. Under ordinary conditions, excessive molecular weight proteins withinside the plasma (e.g., albumin and globulin) can't skip via the filtration membrane because of the results of the scale barrier and rate barrier of the glomerular capillary filtration membrane. Proteins are not normal constituents of the glomerular filtrate.

To learn more glomerulus check the link below:

https://brainly.com/question/7175191

#SPJ4

landslides are an example of

weathering

erosion

deposition

chemical change

Answers

I hope Answer is erosion

pretty sure it’s erosion :)

Using a microscope, you observe an amoeba moving toward a food source. This is an example of
A) reproduction.
B) cellular structure.
C) metabolism.
D) growth.
E) responsiveness.

Answers

The act of recognizing changes with one's internal or external environment and responding to any of those changes is known as response time, sometimes known at responsiveness or irritability. It consists of sensing a stimulus and responding to it.

What is meant by "responsiveness"?

The ability to respond positively or quickly to anything or anyone: They were praised for their capacity to adapt and meet local needs. She doesn't pay much attention to her surroundings.

Why is being responsive so important? It is what?

Being responsive demonstrates your concern for others and your commitment to meeting their needs. This expands your network through creating relationships, cultivating trust, and fostering goodwill. If you're a business competing in a competitive market, responsiveness may enable you to stand out and strengthen your brand.

To know about more responsiveness visit:

brainly.com/question/10025293

#SPJ4

Other Questions
round to the nearest ten Match the following communication systems with their descriptions:Please help!! I need the answer ASAP Another poem. Ik Karens two in one day. And also my teacher gives me extra credit for my poems so dont flag. I need a name. Probably watch your mouth. Tell me what I should fix dont be afraid to tell me. Watch your wordsWatch your mouth Speak a sentence And hearts cry outWatch your tone Watch your mouth Because its the heart that needs to talk nowWatch your angry Watch your mouthYour not thinking and words come out Watch your laugh Watch your mouth you may think its funny but they do not now Watch your sad Watch your mouth Your hurt but YOU push others downWatch your cry Watch your mouth You think others are not helping but turn aroundThe things you say hurt So watch your mouth And read this poem when you start to fall out I hopes this helps, you should realize now. What is the greatest common factor of 20 and 65 Only answer question 2 What function should be used to draw a box? In a Boston Consulting Group (BCG) matrix, _____ are businesses that have only a small share of a quickly growing market. What is an equation for the linear function whose graph contains the points (9, 7) and (4, 8)?Enter your answers in the boxes.y = (x9) A company has designed a new cereal box. This new box has a height of 25 cm, a widthof 2.5 cm, and a length of 12.5 cm. Cardboard used to create these boxes is purchasedfrom a wholesale supplier at a rate of 0.00016 cents per square centimeter. What is thecost to produce each box? Inner-city landlords who subdivide large houses into smaller low-income units are practicingO public housing.O redlining.O filtering.O gentrification.O annexation. Which of the following best describes the motivation behind the slave revolt on St. Domingue (later Haiti)? A. The slaves were treated poorly and thought they were free under the revolutionary French government. B. The slaves wanted to gain control of the plantations so they could become rich. C. The slaves wanted better treatment. A line passes through the points (-2,8) and (5,-20) You notice a new, beautiful aquatic plant growing in a local lake. This species has not been seen in the lake before. After doing some research, you believe the plant is a water hyacinth. These plants are not native to the lake and tend to grow in large quantities on the surface of the water. The plants grow and form dense areas of plant material, which blocks sunlight from passing through the plants.Predict the effects of the introduced species on the community structure of the lake ecosystem. What motif is addressed in both forms of poetry brainly? Why did the Allies deliberately avoid firebombing Hiroshima How did the Compromise of 1850 resolve the various disputes over slavery, and who benefitted more from its terms The vertex form of the equation of a parabola is y = 7(x-3)2 + 4. What is the standard form of the equation? A. y = 7x2 - 42x+67 B. y = 7x2 - 6x + 22 C. y = 14x2 - 6x + 22 D. y = 14x2 - 12x + 44 Consider the writing prompt. Explain the role that sit-in protests played in advancing the goals of the civil rights movement. Which research source would be the most relevant source to use to address the prompt? What is called the preamble of the Constitution explain sovereign word used in our Constitution? Please select the word from the list that best fits the definitionTienen mucha luz y color.el cumpleaosla semana santala navidadda de San Patriciofuegos artificialescuatro de julio