Answer:
The unified cell theory states that: all living things are composed of one or more cells; the cell is the basic unit of life; and new cells arise from existing cells. The cell is the fundamental unit of structure and function in living things. All organisms are made up of one or more cells. The cell is the basic unit of structure and organization in organisms. Cells arise from pre-existing cells. A cell is the smallest unit that is typically considered alive and is a fundamental unit of life. All living organisms are composed of cells, from just one unicellular to many trillions multicellular. I hope i helped you
Explanation:
The Salmonella bacteria infect human, when eating contaminated food or water, causing some symptoms as diarrhea. Which part of the alimentary canal is most affected ? A) Mouth B) Intestine C) Oesophagus D) Pharynx
Answer:
B. Intestine
Explanation:
Salmonella bacteria live in the intestines of people, animals and birds. Most people are infected with salmonella by eating foods that have been contaminated by feces. Commonly infected foods include: Raw meat, poultry and seafood.
A change in pH has the greatest impact on which life proces
Answer:
Aquatic Organisms
If the pH of water is too high or too low, the aquatic organisms living within it will die. pH can also affect the solubility and toxicity of chemicals and heavy metals in the water ¹². The majority of aquatic creatures prefer a pH range of 6.5-9.0, though some can live in water with pH levels outside of this range.
Explanation:
Adding more OH- ions increases the pH, making the substance more basic. Increasing the pH will increase the number of OH- ions, so the equilibrium will shift to the left. Decreasing the pH will increase the number of H3 O+ ions; they'll ''use up'' the OH- ions, thus shifting the equilibrium to the right.
easy question - giving brainly if correct !!
Answer:
i think its C
Explanation:
i would go with c
in the course of normal events leading to fertilization and eventually birth, the route of the egg, embryo, and finally fetus is from the ovary into the __________.
Answer:
uterus
Explanation:
which muscle is used when giving your grandmother a kiss on the cheek?
Sternocleidomastoid
Explanation:
in an otherwise normal cell, what happens if one mistake is made during dna replication?
Answer:
Most mistakes are corrected, and if they are not, they may result in a mutation, defined as a permanent change in the DNA sequence. Mutations can be of many types, such as substitution, deletion, insertion, and trinucleotide repeat expansions. Mutations in repair genes may lead to serious consequences such as cancer.
Explanation:
Construct the correct sequence of events for meiosis I, starting at the top.
1. Separated homologues cluster at each pole.
2. Paired homologues align at the equator, microtubules attach to kinetochores of sister chromatids.
3. Microtubules shorten, chiasmata are broken, homologous chromosomes are pulled to opposite poles.
4. Nuclear envelope re-forms around each daughter nucleus.
5. Chromosomes condense, forming of spindle apparatus begins, homologous chromosomes pair and crossing over occurs.
The sequence of events in meiosis I is first 'chromosomes condense and crossing over occurs', second 'paired homologues align at the equator', third 'chromosomes are pulled to opposite poles', fourth 'separated homologues cluster at each pole' and fifth 'nuclear envelope re-forms around each daughter nucleus'.
Meiosis is a reductional cell division by which a parent cell produces four daughter cells with half of the genetic material.
Meiosis can be divided into meiosis I and meiosis II.
During prophase I (meiosis I),
Chromosomes condenseBegins the formation of the spindle apparatus from cytoskeleton present in the cytoplasmThe homo-logous chromosomes pair and crossing over occurs. Crossing over refers to the interchange of genetic material between non-sister chromatids.During metaphase I,
The homo-logous chromosomes align at the equator plate of the cellThe microtubules attach to the kinetochores of sister chromatidsDuring anaphase I,
The microtubules shortenThe chiasmata, which link homo-logous chromosomes together until anaphase I, are brokenThe homo-logous chromosomes are pulled to opposite poles, thereby, one chromosome of each pair randomly moves to one pole of the cell and the homologous chromosome to the other.During telophase I,
The separated homologous chromosomes cluster at each pole of the new cellsThe nuclear envelope is formed around each cell nucleus.Learn more in:
https://brainly.com/question/2095046?referrer=searchResults
1. When “cleaning” a cadaver, what is removed to better see defined muscles?
When cleaning a cadaver, a professional will remove the fascia in order to better see defined muscles.
The fascia is a thin layer of connective tissue that wraps muscles. It is membraneous and extends throughout the entire body. Among the many functions of the fascia are:
Protectionisolation CompartmentalizationOf its functions, the last it's perhaps the most relevant to this question. It divided the muscles into groups. This is one of the main reasons that in order to see and properly study the muscles of a cadaver, the professional must remove the fascia.
To learn more visit:
https://brainly.com/question/262544?referrer=searchResults
Answer:
deep fascia
Explanation:
what is the name of the tiny air sacs in your lungs?
Answer:
alveoli
Explanation:
to which part of a dna molecule are nucleotides added?
Answer:
Nucleotides are exclusively added to the 3' end of the developing strand when DNA is produced in the 5'-to-3' orientation. The 5'-phosphate group of the new nucleotide attaches to the 3'-OH group of the final nucleotide of the developing strand.
At the 3' end of the deoxyribose sugar, an upcoming nucleotide is added. The existing nucleotide's 3'-OH end and the new nucleotide's 5' phosphate make a phosphodiester bond. In this way, new nucleotides are added.
How does DNA polymerize?
The DNA is made up of nucleotides. Each nucleotide of DNA is made up of a deoxyribose sugar, a phosphate group, and a nitrogenous base. Nitrogenous bases include adenine, guanine, cytosine, and thymine. The sugar of the DNA has a lack of oxygen at the 2' end. A glycosidic bond connects the sugar's 1' end to the nitrogen base.
The 5' end of sugar is attached to the phosphate group. The 3' end of sugar is attached to the 5' phosphate of the new upcoming nucleotide. A phosphodiester bond is formed during the addition of new nucleotides. Two phosphate groups of the new nucleotides are removed. Example: If ATP comes, then it will make AMP and attach to the DNA chain.
Hence, at the 3' -OH end of sugar of the existing nucleotides, a new one is added.
To learn more about the DNA, refer to the following link.
https://brainly.com/question/10134612
#SPJ5
where does pyruvate oxidation occur in eukaryotic cells
Answer:
mitochondrial matrix
Explanation:
Answer:
Pyruvate is produced during glycolysis in the cytoplasm, but pyruvate oxidation occurs in the mitochondrial matrix (in eukaryotes).
please give me crown thank you
Explanation:
what are the two major anatomical subdivisions of the nervous system?
Answer: The nervous system has two main parts:
The central nervous system is made up of the brain and spinal cord.
The peripheral nervous system is made up of nerves that branch off from the spinal cord and extend to all parts of the body.
Explanation:
Origina
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTCTTCTT
mRNA:
AAS:
Mutation 1
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGTAACTCATTTCTTCT
mRNA :
AAS:
Mutation 2
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAGTTCATTTCTTCTT
mRNA:
AAS:
Mutation 3
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTTTTCTT
mRNA:
AAS:
Answer:
y is there so much letters?
plz answer correctly. thank you.
Answer:
Mitosis and cytokinesis
Explanation:
Answer:
see below
Explanation:
1) A- Interphase and mitosis
2) Interphase
tumors can coerce the formation of blood vessels to serve the cancer cells within the tissue. what is this process called?
Answer:
Such tumors, unless they secrete hormones, cause few problems. However, most tumors induce the formation of new blood vessels that invade the tumor and nourish it, a process called angiogenesis.
Explanation:
Which of the following elements is not a metalloid?
Answer:
gallium
Explanation:
I need help with this the 3 blanks where it says answer
Answer:
C will pair with G
then C will pair with G
write G and C
Explanation:
because Adanine(A) always pairs with thymine(T) and cytosine(C) with guanine(G) an easy way to remember this is by Apple Tree and Car Garage.
hope this helps :)
why do multicellular organisms have emergent properties
Answer:
They have more genes than unicellular organisms.
Explanation:
They show properties that can only result from the interaction of many cells.
Marco has experienced extreme fatigue (tiredness) lately. He eats three balanced meals each day and exercises 2-3 times per week on his Peloton bike. He gets 7-8 hours of sleep each night, but just can’t seem to stay awake during the day. Which organelle is most likely causing Marco’s problems?
Given the symptoms shown by Marcos, we can infer that the organelle that may be causing his problems is the mitochondria.
The mitochondria are one of the most famous and important organelle within a cell. Found in most eukaryotic cells, they are the organelle responsible for most of the energy production of a cell, and throughout the cells of the body, they become responsible for the energy production of the organism. This is the origin of its famous "Powerhouse of the cell" title. Mitochondria produce energy in the form of ATP.
ATP is a molecular compound necessary for most of the reactions that take place in a cell. It is so common as a requirement for any cellular activity that ATP is known as the "molecular currency". Marcos is said to be experiencing chronic fatigue, which is a symptom of mitochondrial disease. When the mitochondria of an organism's cells are not functioning as they should be, the cells do not have the energy needed to perform basic functions.
In reaction to this, the body sends signals to the brain to go to sleep, which minimizes energy consumption by slowing down the metabolic processes which require ATP and thus gives the body time to produce more energy. For these reasons, we can conclude that the fatigue and problems Marcos is experiencing are due to mitochondrial disease.
To learn more visit:
https://brainly.com/question/1563697?referrer=searchResults
which muscle group relates best with the term midline?
The oblique is the muscle group that best relates with the term midline.
The anterolateral abdominal wall contains a muscle group in which there are flat muscles whose fibers originate in the posterolateral part, pass forward and become an aponeurosis towards the midline:
The external oblique muscle is the thickest and most superficial of the three muscles on the lateral wall of the abdomen.It follows an inferomedial direction and the muscle-tendon limit descends in such a way that, towards the midline and also below the height of the anterior superior iliac spine, it is completely transformed into an aponeurosis.The aponeurosis of the external oblique joins that of the internal oblique and passes in front of the rectus abdominis; its fibers intersect in the midline with those on the opposite side and contribute to the linea alba.
Therefore, we can conclude that the oblique is the muscle group that best relates with the term midline.
Learn more here: https://brainly.com/question/19486604
_____ is the process by which energy is stored in inorganic molecules is used to produce carbohydrate food molecules
Answer:
Chemosynthesis
Chemosynthesis is used to produce food using the chemical energy stored in inorganic molecules.
that is the answer
Photosynthesis is the process by which energy stored in inorganic molecules is used to produce carbohydrate food molecules.
What is photosynthesis?Photosynthesis is the primary process by which plants, algae, and some bacteria capture and store energy from the sun.
During photosynthesis, light energy is absorbed by pigment molecules in the chloroplasts of plant cells. This energy is then used to convert carbon dioxide (CO2) and water (H2O) into glucose (C6H12O6) and oxygen (O2). The glucose produced during photosynthesis is used by the plant as a source of energy and is also stored as a carbohydrate reserve. The oxygen produced during photosynthesis is released into the atmosphere as a byproduct.
Learn more about photosynthesis, here:
https://brainly.com/question/29764662
#SPJ5
Organize these rock layer from youngest to oldest
Breccia
Conglomerate
Dolostone
Shale
From youngest to oldest are Breccia, Conglomerate, Dolostone, and Shale, and as per geology, the principle of superposition states that in a sequence of layered rocks, the youngest layer is on top and the oldest layer is at the bottom.
What are rock layers?Breccia is the youngest layer in the sequence. Breccia is a coarse-grained sedimentary rock made up of angular fragments of other rocks that have been cemented together. It is formed through a process called brecciation. Conglomerate is also a coarse-grained sedimentary rock, but unlike breccia, its fragments are rounded and well-worn, indicating that they have been transported over a distance by water or wind before being deposited and cemented, and dolostone is older than both breccia and conglomerate. Shale is the oldest layer in the sequence.
Hence, From youngest to oldest are Breccia, Conglomerate, Dolostone, and Shale.
Learn more about the rock layers here.
https://brainly.com/question/19598172
#SPJ2
What is the rounded upper end of the humerus, which fits like a ball into the glenoid cavity of the scapula?
Answer:
a. the head
Explanation:
I need some help summarizing the following topics
•Biology Foundations
•Cells
•Energy and Transport
• Reproduction and Cell Division
• Classical Genetics
• Molecular Genetics
• Human Body Systems
• Ecology
Answer:
guess we were in the same boat I have
Explanation:
Chris to ryx Dr and decor is nuryslam is a day at a retirement party and I have to go to khow about the election results and I we are and decor and I have a lot earlier today
Name given to the two new cells formed at the end of cell division.
Answer:
Diploid cells
Explanation:
The daughter cells from mitosis are called diploid cells. Diploid cells have two complete sets of chromosomes.
justify the statement conservation of forest helps in the protection of environment
Answer:
conservation of forests helps in protection of environment as forests gives food fodder and shelter to animals
Explanation:
The importance of forests cannot be underestimated. We depend on forests for our survival, from the air we breathe to the wood we use. Besides providing habitats for animals and livelihoods for humans, forests also offer watershed protection, prevent soil erosion and mitigate climate change.
Explain how the method of nutrition used by wild pine differs from the method of nutrition used by other organisms (animals)
Answer:
Most plants are auto trophic able to use sunlight as their primary source of energy,in a process called photosynthesis.This process enables them to turn carbon dioxide from the air into food,The carbon and oxygen which they need in order to build up their bodies ultimately comes from this carbon dioxide.
All animals are heterotrophs, which means that they cannot make their own food as plants do. Rather, animals must obtain the energy, carbon, hydrogen, oxygen, nitrogen, and minerals they need by consuming other living things. Animals are also animate, which means that they are capable of movement.
How does thermal energy impact the lower layers of atmosphere?
Answer:
Explanation:
Land and water absorb most of the solar radiation from the sun. Some of this solar energy from land and water is then transferred to the lower atmosphere which is in contact with the continents and oceans. From Land, this occurs mostly as heat energy or infrared radiation. Water usually transfers this energy through the evaporation of water into the atmosphere
what is the most durable part of the human body?
Answer:
the most durable and tough substance in your body is actually a tissue. Encasing your teeth and helping you chew, bite, and tear your food is your tooth enamel. That's the hardest substance in the human body.
Explanation:
The most durable part of the human body is Tooth Enamel.
What is Tooth Enamel?Tooth enamel is defined as the thin outer covering of the tooth that covers the crown of the tooth. This is the part that we can see outside the gums. This is the outer layer, the enamel is transparent. Dentin is the hard tissue that lies beneath the enamel, and is what gives teeth their color.
Once tooth enamel is damaged, it cannot be restored. Enamel can be restored to some extent by improving its mineral content. Enamel is the durable part of the human body.
While toothpaste and mouthwash can never "rebuild" teeth, they can contribute to this remineralization process.
Thus, the most durable part of the human body is Tooth Enamel.
Learn more about Tooth Enamel, here:
https://brainly.com/question/14138833
#SPJ2
help
Facilitated diffusion uses -----------------to help aid some substances across the cell membrane.
Facilitated diffusion uses transport proteins to help aid some substances across the cell membrane.
Facilitated diffusion is a passive transport process that enables the movement of specific molecules across the cell membrane with the assistance of transport proteins. While simple diffusion allows small, non-polar molecules to pass directly through the lipid bilayer of the cell membrane, facilitated diffusion comes into play when larger molecules or molecules with charges need to cross.
Transport proteins act as gateways or channels in the cell membrane. They are selective and only allow specific molecules to pass through. There are two main types of transport proteins involved in facilitated diffusion: channel proteins and carrier proteins.
Channel Proteins: These proteins form pores or channels in the cell membrane, allowing certain molecules, such as ions or water, to pass through. Channel proteins are highly specific and only allow certain substances to cross.
Carrier Proteins: These proteins undergo a change in shape to "carry" molecules across the membrane. When a specific molecule binds to the carrier protein, it triggers a change in the protein's shape that transports the molecule across the membrane. Once the molecule is released on the other side, the carrier protein returns to its original shape.
Facilitated diffusion is a crucial process for maintaining the balance of ions and molecules inside and outside the cell. It's important for the transport of nutrients, ions, and other essential molecules that may be too large or polar to diffuse directly through the lipid bilayer. The involvement of transport proteins ensures that only specific substances are transported, preventing unwanted molecules from entering or leaving the cell. Overall, facilitated diffusion is a highly regulated process that contributes to the homeostasis of the cell and the overall functioning of the organism.
To learn more about Facilitated diffusion, here
https://brainly.com/question/17132249
#SPJ3