All of the following had an impact on increasing consumerism in America except



Select one:
a. department store concept
b. higher wages being paid due to success with unions
c. chain stores
d. new methods of advertising

Answers

Answer 1

Answer:

a. department store concept

Explanation:

The above options given above encourages consumerism except the concept of department stores. For example, most department store sells high end products which is very costly unlike chain stores that has so many products sold across the country at a cheaper price. Example is the Walmart Stores which is a chain store.


Related Questions

What reason do historians give for a decline in the status of women after the Neolithic Revolution?
This is a free response question. Please help ASAP!!

Answers

Answer:

Women lost social standing and freedom

Explanation:

What was the cause of the townshend acts 1767

Answers

Answer:

Townshend Acts, 1767, originated by Charles Townshend and passed by the English Parliament shortly after the repeal of the Stamp Act . They were designed to collect revenue from the colonists in America by putting customs duties on imports of glass, lead, paints, paper, and tea.

Explanation:

Answer:

Explanation:

The cause of the Townshend Acts, a series of measures imposed upon the American colonists, was the British desire to raise revenue, punish the colonists and assert the authority of the British Parliament. The effects of the acts were widespread dissatisfaction, protests, a boycott of British goods and other civil unrest leading up to the Boston Massacre, at which five American civilians were killed by British soldiers.

HELP ASAP!!!!!!!!!!!!!! PLEASE
Compare and contrast Lipans and the Mescalaros tribe

Answers

Answer: compare

Proteins (polymers of amino acids)

Carbohydrates (polymers of sugars)

Lipids (polymers of lipid monomers)

Nucleic acids (DNA and RNA; polymers of nucleotides)

contrast

Explanation:

Can some one help me plz ASAP?




Look at the map on page seven and use
the information above and decide who got
the better end of the deal the North or the
South? How do you think this could cause
problems in the future?
Why do you feel like these compromises
brought us closer to war?

Answers

Hold up AM WATCHIBB TIK TOK

what was stalin’s first five year plan? why was it put into effect?

Answers

Answer:

Stalin realised that if Russia was to become a key player in the global market, the country needed to industrialise rapidly and increase production. To do this, Stalin introduced the Five-year Plans.

Explanation:

Which of the following is true about the Quran?

A. Is said to be the direct word of Allah spoken to Muhammad

B. It was written by Muhammad and his disciples before he died

C. It was written by Jesus and his disciples before he died

D. It was later altered and edited by Sunni and Shia Muslims

Answers

Answer:

the answer is

Explanation:

a) Is said to be the direct word of Allah spoken to Muhammad

A. Because allah is spoken to muhammad

Do you think our language, culture, and day-to-day life might be different if the Spanish had overtaken the Jamestown colony and other colonies in the northeast? Why or why not?

Answers

Answer:

Yes, language and culture would be different, daily life not necessarily so.

Explanation:

If the Spanish had overtaken the Jamestown colony, and had expanded from there to other parts of North America, they would have sent settlers from Spain to promote their language and religion: Spanish and Christian Catholicism, respectively.

The U.S. would still be a Western Nation, but more similar to Latin America than it is right now.

Daily life would not necessarily be that different. The country would have likely industrialized, and then, become a service-based economy, meaning that most people would have more or less the same lifestyle and jobs that they have today.

Which countries did the British colonize? 1850-1914

Answers

Answer:

Anguilla

Bermuda

British Antarctic Territory

British Indian Ocean Territory

British Virgin Islands

Cayman Islands

Falkland Islands

Gibraltar

Name 3 things Germany did that upset the us

Answers

Germany declared a war on America

2,403 Americans died in Pearl Harbor

we lost 52 subs in wwII

Germany sunk one of US biggest Aircraft's carriers Known as the USS Hornet it's planes had sunken the biggest warship in world war two.

Georgia's first Bill of Rights was created in its Constitution in

A.) 1851.
B.) 1861.
C.) 1871.
D.) 1881.

Answers

Answer:

C. 1871

Explanation:

3dgenuity >.<

Answer:

1861

Explanation:

the first answer is wrong

Why do you think the English were winning The hundereds years war at first

Answers

Answer:

The Hundred Years' War was fought between France and England during the late Middle Ages. The war started because Charles IV of France died in 1328 without an immediate male heir (i.e., a son or younger brother). Edward III of England then believed he had the right to become the new king of France through his mother.

Explanation:

Which of the following was NOT one of Martin Luther's beliefs? (WHII.3a)
a
Salvation by Faith alone
b
People should read and interpret the Bible for themselves
c
Church teachings should come from the papacy
d
People should be able to read the Bible in their own vernacular

Answers

Answer:

I think its A

Explanation:

Salvation by Faith alone of the following was not one of Martin Luther's beliefs. The correct option is A. Luther held that salvation is by grace through faith alone and that this sums up all of the Christian doctrines. He believed that the Catholic Church of his day had misunderstood this and had made a mistake. Contrary to Protestants, it is frequently claimed that Catholics think salvation requires both faith and works.

Who was Martin Luther What were his religious beliefs?

In 1507, Luther received his ordination as a priest. In particular, he disagreed with the Roman Catholic Church's position on indulgences. He eventually came to reject a number of its teachings and practices. In his 95 Theses from 1517, Luther outlined a theoretical analysis of the use and effectiveness of indulgences.

The core of Protestantism was shaped by his central teachings, which stressed the importance of the Bible as the sole source of religious authority and the necessity of salvation through faith rather than works. Luther disassociated himself from the radical successors who took up his mantle despite his criticism of the Catholic Church.

Thus, the ideal selection is option A.

Learn more about Martin Luther here:

https://brainly.com/question/19340322

#SPJ2

What are two most profitable ways to make money in New France

Answers

Answer:

The fur trade was the real economic driver of New France. The harvesting of furs created wealth, stimulated the exploration of the continent and created alliances with many Aboriginal peoples.  Fishing was also a very profitable way to make money in New France

Have a wonderful day! :D

What sort of power is Congress's ability to levy taxes?
Choose 1 answer:
implied because it is hinted at in the Constitution
B
enumerated because the president gives them the power to do so
implied because it has no basis in the Constitution
enumerated because it is written in the Constitution

Answers

Enumerated because it is written in the Constitution.

"Speak softly and carry a big stick" went along with the:*​

Answers

Answer:

President Roosevelt's saying was “speak softly, but carry a big stick”, meaning that the U.S. would stay out of Latin American problems unless they needed to get involved. It was the Spanish american war

Explanation:

That's president Roosevelt saying that

compare and contrast the spanish and the indians in their relationships. 1 paragraph in their similarities. 1 paragraph in their differences

Answers

Kydhhcculfjckgkh clxcpuldipgoh viogclcpi

Frances Trask was awarded a land grant by the colonies in honor of her contributions to education in Texas

○True
○False ​

Answers

Answer: true- Frances Trask was awarded a land grant by the colonies in honor of her contributions to education in Texas.

Explanation: She helped her husband found the city of Victoria, gave the money for the first church in Victoria and contributed aid to Texas during its war effort with Mexico.

Who Wanted to build new routes

Answers

Answer:

President Eisenhower

Explanation:

Eisenhower was responsible for establishing the new interstate highways.

Explain why things fell apart at the Meeting of the Estates General.

Answers

Answer:

The Estates-General of 1789 was the first meeting since 1614 of the French Estates-General, a general assembly representing the French estates of the realm. Summoned by King Louis XVI to propose solutions to his government's financial problems, the Estates-General convened for several weeks in May and June 1789.

The study of geography provides clues to all of the following

Answers

Could you give options??

During World War II, Vietnam was occupied by
A) Italy
B) Japan
C) Germany
D) Great Britain

Answers

Answer:

Japan

Explanation:

The interaction between the minutemen and the British troops at Lexington and Concord was significant because

Answers

Answer:

It was the first battle of the Revolutionary War

Explanation:

Under the task system, when were slaves allowed to raise their own livestock?
a.
before they started their tasks
c.
never
b.
anytime
d.
when they finished their tasks

Answers

Answer: D

Explanation: “Each day slaves were required to achieve a precise work objective, a labor system known as the task system. This allowed them to leave the fields early in the afternoon to tend their own gardens and raise their own livestock.”

Why is Earth more likely to support human life than the other planets in our solar system?

Answers

Earth is most likely to support human life because of it's resources, like food, water, shelter, and air.

Other planets and exoplanets do not have these features. This is why Earth is super-valuable and one of a kind.

How might life have improved for the Pueblo people when they relocated to the land near the Rio Grande?

Answers

Answer:

They had a source of water close to them.

Explanation:

Life improved for the Pueblo people when they relocated to the land near the Rio Grande as they have available resources of water near them.

Why do Pueblo people relocate?

Pueblo people relocate due to lack of water resources and drought caused it to appear as difficult to grow food and allow for the survival of almost tens of thousands of people living in the community.

The Pueblo families migrate south in the 1300s and largely settled in northeastern Arizona and northwestern New Mexico due to a lack of natural resources or ethnic conflict strife.

The fact that the Native Americans known as the Pueblos protested against the Spanish conquistadors after experiencing religious persecution, bloodshed, and drought is evidence of the occurrence of ethnic conflict strife.

Learn more about Pueblo, here:

https://brainly.com/question/17236050

#SPJ2

What did people outside of the USA hear about the declaration of independence after 1776?

Answers

Answer:

The sovereignty of states

Explanation:

"The sovereignty of states, as laid out in the opening and closing paragraphs of the American Declaration, was the main message other peoples beyond America heard in the document after 1776."

which of the following was a characteristic of the Virginia House of burgesses

Answers

Answer:

Explanation:

A

What was the cause of slavery?

Answers

Slavery was introduced wind a Dutch ship traded African slaves for food in 1619. When White settlers were unable to find cheap labour they turn to the slaves imported from Africa.

High tariffs led to:
A. increased sales of American crops overseas.
B. devastation for American manufacturers.
C. American farmers having difficulty selling crops overseas.
D. the closing of many American factories.
help

Answers

Answer:

C

Explanation:

i got it right on a.p.e.x

High Tariffs led to American farmers having difficulty selling crops overseas.  Thus, the appropriate answer choice is option C.

Imports are constrained by tariffs. Simply expressed, they raise the cost of products and services bought from another nation, making them less alluring to domestic customers.

Understanding how a tariff impacts the exporting nation is crucial since consumers there may be less likely to buy imports as a result of the tariff's price increase. The tax has, however, essentially increased the cost to the consumer in another country if the consumer choose to purchase the imported good.

Hence, option C is the correct answer.

To learn more on tariff, here:

https://brainly.com/question/22685610

#SPJ4

Which climate conditions best describe the Fertile Crescent?

Answers

Answer:

The climate was semi-arid but the humidity, and proximity of the Tigris and Euphrates Rivers (and, further south, the Nile), encouraged the cultivation of crops.

Climate conditions which best describe the Fertile Crescent are warm and damp climatic conditions.

What is Fertile Crescent?

Some of the first human civilizations rose in the Middle East's Fertile Crescent, a boomerang-shaped area. This region, frequently referred to as the "Cradle of Civilization," gave rise to several technical advancements, including writing, the wheel, agriculture, and irrigation.

Its region encompasses Turkey, Iran, southern Iraq, Syria, Lebanon, Jordan, Palestine, and Israel. The Tigris and Euphrates rivers regularly cause flooding in the area, and a tiny portion of the Nile River also flows through it. The Middle East's lush Crescent was a fertile region that, in a semicircle, stretched from Israel to the Persian Gulf.

The oldest agriculture in human history emerged in the Fertile Crescent. Due to the ability to feed a sizable non-farming population, the first cities and empires were able to emerge.

Learn more about Fertile Crescent, here:

https://brainly.com/question/18060621

#SPJ6

Other Questions
Carbon decays every 5700 years. If you found a rock containing Carbon that has gone through 2.5 half lives, how old is that rock? Love after Love By Derek Walcott What are machines fueled by?1. Energy 2. Electricity only3. gasoline only4. Sun You measure containers for international shipments. The height of the standard container is 6 feet and 7 inches. What is the height in meters? TIME REMAINING52:45The robotic rover Curiosity has instruments that detect radiation both inside the spacecraft and in the Mars environment. What is most likely the purpose of this radiation detection?to determine whether human exploration of Mars is possibleto develop better X-ray technologyto find evidence of once-living Martian microorganismsto investigate evidence of hydrogen and water (1/3)^2=? I need help with math I'm failing, because of my teacher By finding out who Figaro's parents are how does this inconvenience the Count? Starting from rest, a car travels 18 meters as it accelerates uniformly for 3.0 seconds. What is the magnitude of the car's acceleration? A. 6.0 m/s2 B. 2.0 m/s2 C. 3.0 m/s2 D. 4.0 m/s2 78There are 32 desks in a room.If x represents the number of rows of desks, which expression would equal the number of desks in each row?0 32 + x32 - xO 320 3/x Rafael can type 24 words in 6 minutes. What is his rate in words per minute what happen when two light waves traveling from oppsite direactions meet? if a doctor states that a patient has a bone break in the left anterior portion of their body, lateral to midline in their thoracic cavity, what can you assume im broken? In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services. 275,000 plus 5.4 times 10 to the 5th power Whats a religion ??? Javier has a basket of oranges and apples. The number of oranges is 2 more than twice the number of apples in the basket. The difference of half the number of oranges and half the number of apples is 4.An equation created to find the number of apples Javier has in the basket will have What are all the correct equations