Are
getting a trophy?
Choose the word or words that make the sentence coherent.
a) everybody
b) the team in third place
c) Jerome or Ana
d) the winners

Answers

Answer 1
D. sorry if this is wrong
Answer 2

Answer:

B

Explanation:

IT'S TALKING ABOUT THE TEAM THAT WILL BE GETTING A TROPHY BECAUSE COHERENT ABLT TO SPEAK CLEARLY AND LOGICALLY

MY DAUGHTER THATS A SENIOR HIGH SCHOOL HELPED ME WITH THIS ?


Related Questions

. Write an article on the topic- Stop using plastic bags. in 200 word

Answers

Plastic bags have become a ubiquitous part of our daily lives, but they are also a major source of pollution and environmental degradation. Every year, millions of plastic bags end up in landfills, where they can take hundreds of years to break down, or in the ocean, where they can have devastating effects on marine life.

The use of plastic bags has also been linked to a number of other environmental problems, including deforestation, as trees are often cut down to make way for plastic production. They also contribute to climate change, as the production and transportation of plastic bags requires the use of fossil fuels.

Despite these issues, plastic bags are still widely used, often for just a few minutes before being thrown away. This is why it is so important for us to stop using plastic bags and switch to more sustainable alternatives.

There are a number of alternatives to plastic bags that are just as convenient and affordable, including reusable cloth bags, paper bags, and even biodegradable plastic bags. These options are not only better for the environment, but they can also save you money in the long run, as you won't have to constantly buy new plastic bags.

By making the switch to more sustainable alternatives, we can help reduce plastic pollution and protect the environment for future generations. So next time you go shopping, remember to bring your own bag and help stop the use of plastic bags.

He was knocked out in the fight and they had to throw water on him to bring him ...
1. back
2. round
3. in
4. over​

Answers

The answer is back. The first choice.

Can someone help me write an essay on how there’s racism in the book “The Watsons Go to Birmingham 1963” By Christopher Paul Curtis?

Answers

Answer:

In Christopher Paul Curtis’ novel, The Watsons Go to Birmingham 1963, racism is a pervasive theme throughout the story. The novel is set in 1963, a time when the Civil Rights Movement was gaining momentum, and racism was still rampant in the South. The Watsons, an African-American family living in Flint, Michigan, decide to take a road trip to Birmingham, Alabama, to visit their grandmother. Along the way, they experience firsthand the racism that was pervasive in the South.

One example of racism in the novel is when the Watsons stop at a diner in Tennessee and are refused service. The waitress tells them that they don’t serve African Americans, and Kenny, one of the Watsons’ children, is shocked by the blatant racism. This scene is a stark reminder of the discrimination that African Americans faced during this time.

Another example of racism in the novel is when the Watsons arrive in Birmingham and experience the racism of the city firsthand. Kenny is warned not to go out in the city, as it is dangerous for African Americans. Later, the Watsons attend a church service, where they are segregated from the white churchgoers. This scene is a powerful reminder of the racism that African Americans faced in the South during this time.

Finally, the novel also shows the racism that African Americans faced in the North. The Watsons face discrimination when they are looking for a place to stay in Birmingham, as they are turned away from several hotels because of their race. This scene shows that even in the North, African Americans were not immune to racism.

Overall, racism is a pervasive theme throughout The Watsons Go to Birmingham 1963. Through the experiences of the Watsons, the novel shows the racism that African Americans faced in the South and North during the Civil Rights Movement.

Explanation:

Sure, I'd be happy to help you write an essay about racism in "The Watsons Go to Birmingham 1963."

In the book, racism is a major theme and is depicted through the experiences of the Watson family, who are African American, as they travel from Flint, Michigan to Birmingham, Alabama in 1963. Throughout the book, the Watsons face segregation and discrimination, as well as the threat of violence, due to the color of their skin.

One example of racism in the book is when the Watsons visit a department store in Birmingham and are not allowed to try on clothes or use the fitting rooms because of their race. This experience demonstrates the systemic discrimination that African Americans faced during this time period and the ways in which they were treated unfairly and with disrespect.

Another example of racism in the book is when the Watsons witness the bombing of the 16th Street Baptist Church in Birmingham, an act of racial terror that resulted in the deaths of four young African American girls. This event serves as a reminder of the harsh realities of racism and the devastating impact it can have on individuals and communities.

Overall, "The Watsons Go to Birmingham 1963" is a poignant and powerful exploration of the themes of racism and discrimination. It serves as a reminder of the struggles and challenges that African Americans faced during this time period, and the importance of continuing to work towards a more just and equitable society.

What is a central idea of the excerpt from Chapter 3 of Why We Love?

Answers

Answer:

The central idea of the excerpt is In equal roles, men and women will establish more meaningful marriages

Explanation:

Identify the nouns in the following paragraph

At midday we were served with the heaviest meal of the week. We sat around the dining- room table stiff and Uncomfortable in our navy-blue best. After a long drawn out grace we started with curry and yellow rice rich with raisins and cinnamon. The curry was pale and anaemic because my aunt, who always lunched with us on Sundays, claimed to suffer from acid winds. But after that we had thick slices of roast potatoes smothered in gravy, and red beetroot salad. And finally jelly and custard and sometimes bread or rice pudding.​

Answers

Answer:

Explanation:

Common Noun

1. Blue

2. NAVY

3. Aunt

4. Proper Noun

5. Sunday

6. Anaemic

7. Acid winds

8. Table

Uncountable nouns

1. Curry

2. Jelly

3. Pudding

4. Rice

5. Custard

6. Bread

Demonstrative Noun

1. Thick

2. Pale

3. Heaviest

4. Stiff

5. Grace

If 4 ears of corn cost $2 how much would 16 ears of corn cost

Answers

Answer:

32

Explanation:

pretty sure your just multiplying it

jesse wants to make a line plot to display the data shown how many x's should he put above 8.5

Answers

fAnswer:

g

Explanation:

Directions.

Decide if must expresses certainty or necessity.

You don't look well. You must sit down for a minute

certainty


necessity

Answers

The correct answer B. Necessity.

Explanation

Modal verbs are auxiliary verbs used in English to express an opinion about whether something is probable or possible. They are also used for over-ability, to ask permission, or to make a request. The modal verbs are: Can, May, Will, Ought to, Must, Could, Might, Shall, Should to and Would.

In the case of the sentence "You don't look well. You must sit down for a minute" the modal verb must is used to refer to a suggestion to sit down since whoever says the sentence sees as a need that the person sits to make him/her feel better. Therefore, the correct answer is B. Necessity.

Did I do this question right?

Answers

╭┄┈┄────────❥

Answer:

↣ In order for revise the sentence to a second person perspective effectively, you must:

    • Change he needs to you need.

Explanation:

A second person point-of-view is a type of perspective that specifically refers to the reader themselves utilizing pronouns such as you, yours, and yourself.

. . • ☆ . ° . • °: . * ₊ ° . ☆

I hope this helps!

peachtea ^-^

╰┄┈┄──❥

What did Kenny's parents not talk about in chapter 2

Answers

Answer:

What book is this for?

I'm so sorry I would help but what is the book?

Explanation:

this is for commonlit pls right answers only and ASAP pls I just need part B but i’ll leave part A for context* Part B: Which TWO sections best support the answers to Part A?
A:”As rising water and widespread devastation hobbled rescue and recovery efforts, the authorities could only guess at the death toll in New Orleans and across the Gulf Coast.” (Paragraph 4)
B: “It was not the water from the sky but the water that broke through the city’s protective barriers that changed everything for the worse.”( paragraph 9).
C: “Mayor Nagin said that one of the levee breaches was two to three blocks long, and that the Federal Emergency Management Agency had been dropping 3,000-pound sandbags into the opening from helicopters”(paragraph 11)
D:”Preliminary damage estimates from insurance experts on Monday ranged from $9 billion to $16 billion , but they were pushed up past $25 billion on tuesday,”( paragraph 20)
E: “getting food and water into the city was an urgent priority. Officials said that there was only one way for emergency vehicles to get into parts of the city to bring in supplies”.( paragraph 29)
F: “We’ve been saying that the response is going to be the largest Red Cross response in the history of the organization.”(paragraph 43).

Part A I’ll leave it right here with the answers* Part A: Which TWO statements express the central ideas of the text?
A: Authorities in New orleans weren’t prepared for the chaos and destruction that would result from the leeves breaking and the resulting flood.
F: Louisiana didn’t have the proper plans in place to respond to a disaster of this magnitude, and because of this they lost more citizens than expected.

Answers

Answer:

f

Explanation:

URGENT, NEED HELP!!

Compare and contrast the short stories “War” by Jack London and “A horseman in the sky” by Ambrose Bierce.
Assignment Details:
-one page essay (about 250 words)
-Short introduction that clearly states the topic and your main points.
-Body text that describes the similarities and/or differences between the works and supports these points with examples from the texts.
-Short conclusion that restates the topic and your main points.

Answers

"A Horseman in the Sky" is a short story that was written by Civil War ex soldier and survivor Ambrose Bierce and it was published in 1889.

What is the theme of A Horseman in the Sky by Ambrose Bierce?

In this tale, Bierce examines the concepts of obligation and family. Carter Druse asserts that he has a great feeling of obligation to his cause, although he appears to be more concerned with his father-rebellion.

The relationship between a father and son is the subject of the true message. In the main conflict, Carter must decide whether or not to shoot the soldier in a man versus self situation. Carter's father is the soldier on the horse, which is what gives the tale its power.

A Horseman in the Sky is narrated by Bierce from a third-person, omniscient point of view. This viewpoint frequently focuses on Carter in the narrative. Because the narrator is omniscient, we can also observe the events from their perspective.

To Learn more aboutA Horseman in the Sky refer to:

https://brainly.com/question/9329850

#SPJ1

The tone is edgar lee masters spoon river anthology

Answers

Answer: B

Explanation:

Answer: B, is both favorable and critical of rural life

Explanation:

List the 10 advantages of diversity

Answers

Answer:

#1: Variety of different perspectives. ...

#2: Increased creativity. ...

#3: Higher innovation. ...

#4: Faster problem-solving. ...

#5: Better decision making. ...

#6: Increased profits. ...

#7: Higher employee engagement. ...

#8: Reduced employee turnover.

#9: Better company reputation

#10: Improved hiring results

Not exactly sure if this is what you were looking for, but I sure hope it helps :)  

Find the subject in the following sentence?

Mr. French has been teaching students for many years.

A.Students
B.Years
C.has been teaching
D.Mr.French

Answers

C. Has been teaching

Question 9(Multiple Choice Worth 5 points)
(MC)

Select the suffix you would find in a word indicating a person who.

Dom
Ism
Ist
Ology

Answers

Answer:

Ist

Explanation:

Scientist, Phycologist etc

Answer:

Its

Explanation:

ist  person who performs an action   dentist

Directions: Answer ALL prompts below with full, specific 6-sentence paragraphs that
make specific references (use quotes from the novel) to the text to support your
answers. In each of your paragraphs for each prompt, include ONE complex sentence
and ONE sentence with the adjectives shifted out of order. These two sentences in
your paragraphs should be highlighted. Only highlight your two required sentences - na
more.
1. From Steinbeck's description of the bunkhouse, what can a reader infer is its
symbolic meaning? By the end of Chapter 2, how do George and Lennie feel
about having to stay in the bunkhouse? Explain.

Answers

From Steinbeck's description of the bunkhouse, a reader can infer that it symbolizes the loneliness, monotony and lack of control that the ranch workers experience.

What is bunkhouse?

A bunkhouse is a type of accommodation, typically found on farms or ranches, that consists of a large, open room with multiple bunk beds. Bunkhouses are most commonly used to house workers, such as seasonal employees or ranch hands.

The "long, rectangular building" with its "square windows" and "tar paper roof" gives the impression of a prison, and the fact that "the walls were whitewashed and the floor unpainted" implies that the workers are not given the opportunity to live in comfort or to be creative with their environment. By the end of Chapter 2, George and Lennie seem resigned to their living conditions in the bunkhouse, despite the fact that it is not an ideal situation. Lennie is "wearily" compliant, while George is more reluctant, complaining to the boss that "You got no right to say I can't have my partner with me. I done my work and he done his." Despite the men's frustration, they ultimately accept the reality of their situation and the need to stay in the bunkhouse.

To learn more about bunkhouse
https://brainly.com/question/30050244
#SPJ1

Read the excerpt from the poem The Arrow and the Song" by Henry Wadsworth Longfellow. Then answer the question that follows.
I shot an arrow into the air,
t fell to earth, I knew not where;
For, so swittly it flew, the sight
Could not follow i in its flight.
breathed a song into the air,
It fell to earth, I knew not where,
For who has sight so keen and strong,
That it can follow the flight of song?
Long, long afterward, in an oak
I found the arrow, still unbroke;
And the song, from beginning to end,
I found again in the heart of a friend
Which of the following statements best explains the poet's use of figurative language?

Answers

In the air, I released an arrow, I'm not sure where it crashed to the ground because it was moving so quickly that it was impossible to follow in the Arrow and the Song.

What part of the poem The Arrow and the Song did the song belong to?

Somewhere on earth, the arrow fell. The poet exhaled the song into the air, making it impossible for the eye to follow the arrow. Somewhere on Earth, the tune dropped.

What does The Arrow and the Song's opening stanza mean?

The poet describes shooting an arrow that quickly went through the air in the first stanza. He is unaware of its exact location on the ground, though.

To know more about the Arrow and the Song visit :-

https://brainly.com/question/28793137

#SPJ1

20 pointssssssssssssssssss please help
What are two impacts that earthquakes can have on humans?

Answers

Answer:

1.) Structural damage to buildings

2.) Landslides

(Hope this helps! Btw, I answered first. Brainliest please! :D)

.
What is the goal of a collaborative discussion?

to debate different opinions and persuade your group members to agree with you
to work together to create a broader and more meaningful understanding of a topic
to read a book together as a team and help anyone who has difficulty or questions
to make sure everyone in the group is able to support a different idea or opinion

Answers

Answer:

I think the answer is B

To work together to create a broader and more meaningful understanding of the topic.

Explanation:

Because the group creates and more depth understanding the topic.

I hope you got it right!!!

Answer:

the answer is b:  to work together to create a broader and more meaningful understanding of a topic

Explanation:

I took the quiz :)

Please help me with the questions please ASAP ASAP please ASAP

Answers

Answer:

In my opinion, conspiracy theories and urban legends are used as scare tactics most of the time. Those who says that certain things exist either don't have enough evidence or someone else told them. It's usually never a firsthand experience they have with these urban legends. Unless there is multiple firsthand witnesses, there is a good chance that most urban legends and conspiracy theories aren't real.

Explanation:

I actually believe in some theories but i thought it'd be cool to write an opposing argument. Hope this helps :)

so i would write about you not believing it because i see that being easyier to do just tell your opinion and you can drag out if you need to just get a paragraph or two out there

What does Balthasar do when Romeo tells him to leave the tomb in Act V of Romeo and Juliet?
A. Agrees to leave, but stays right outside because he is worried about Romeo
B. Argues at first, but eventually leaves
C. Leaves immediately and doesn't look back

Answers

Answer: Option A


explanation: on line 43–44, Balthasar said, “For all this same, I’ll hide me hereabout. His looks I fear, and his intents I doubt.” This sentence reveals that he is concerned for Romeo to be hides and doesn’t actually leave.

Type the correct answer in the box. Spell all words correctly.
What type of messages or images can help fight stereotypes by
providing opposite examples?
messages or images are used to fight stereotypes
by providing evidence of the stereotype being false.

Answers

The most effective way to combat stereotypes is through messages or images.

What does the stereotype represent?

A general conception that many people hold about a particular sort of person or thing—frequently false—is referred to as a stereotyped idea.

The current study looked at how counter-stereotypical images can combat the automatic gender bias that can arise when reading particular nouns associated with social roles and occupations. Participants in two tests conducted a judgment task in which word pairs with a role noun and a stereotype gender prejudice (such as beautician) and a kinship term and a definitional gender bias were presented to them (e.g., brother).

Hence/Therefore,

To learn more about stereotypes from the given link

https://brainly.com/question/27753022

#SPJ1

Which of the following passages from Carr's article includes a simile?
a. And what the Net seems to be doing is chipping away my capacity for concentration and contemplation.
b. They supply the stuff of thought, but they also shape the process of thought.
c. My mind now expects to take in information the way the Net distributes it: in a swiftly moving stream of particles.
d. Once I was a scuba driver in the sea of words. Now I zip along the surface like a guy on a Jet Ski.

Answers

D, because it compares using like

Answer:

D

Explanation:

Just took the quiz

“when an indian fights he only shoots to kill” means

Answers

Answer:

when an indian fights he only shoots to kill”

it is Quotes and it is written by cheif Joseph

Q8 Slaughterhouse Five: How is the narrator indirectly characterized by the action of phone calling people dr*nk late at night?


Select one:

a. The narrator is indirectly characterized as being a party animal who needs to mature.

b. The narrator is indirectly characterized as having a drinking problem that’s ruining his life.

c. The narrator is indirectly characterized as moderate in enjoying his activities responsibly.

d. The narrator is indirectly characterized as still being restless and upset about the war.

Answers

B.

Calling people late at night while dr*nk is a behavior that suggests the narrator may be struggling with substance abuse, which can have negative impacts on many aspects of a person's life. This behavior may be a coping mechanism for the narrator, who is still struggling with the trauma of war and may be using alcohol to numb his emotions.

What does it mean people race?

Answers

Answer:

ethnicity

Explanation:

It’s your background, skin color, and religion.

Read the passage from The Odyssey - Elpenor.

By night
our ship ran onward toward the Ocean's bourne,
the realm and region of the Men of Winter,
hidden in mist and cloud. Never the flaming
eye of Helios lights on those men
at morning, when he climbs the sky of stars,
nor in descending earthward out of heaven;
ruinous night being rove over those wretches.

The Odyssey - Elpenor is an epic poem because it features a(n)

character summoning and talking to the dead.
character sacrificing animals on a remote island.
invocation to an ancient Greek goddess.
important event in ancient Greek history.

Answers

The Odyssey, Elpenor is an epic poem because it features a character summoning and talking to the dead. The correct option is a.

What is The Odyssey about?

The Odyssey is an epic poem in 24 books traditionally attributed to the ancient Greek poet Homer. The poem is the story of Odysseus, king of Ithaca, who wanders for 10 years, although the action of the poem covers only the final six weeks of trying to get home after the Trojan War.

Odysseus returns to his homeland of Ithaca, where he will defeat the rude suitors camped in his palace and reunite with his loyal wife, Penelope.

Learn more about Odyssey, here:

https://brainly.com/question/28666220

#SPJ1

of
for
What does Banquo mean when he says, "There if I grow,
/ The harvest is your own"?
O He needs Duncan's help to complete a task.
He wants to thank Duncan for his assistance.
O
He owes any success he might have to Duncan.
O He appreciates Duncan's invitation to speak.

Answers

Answer:

What Banquo means when he says, "There if I grow, / The harvest is your own” is this:

He owes any success he might have to Duncan.

Explanation:

In this statement, we can see that Banquo was referring to the right of the claim that Duncan had to any success he might have. It is quite clear from this text that he really appreciates the help that Duncan has rendered to him, so any big benefits that he had could be attributed to his friend Duncan.

3.
Independent reading can help students develop automaticity and prosody.

True

False

Answers

False.

Hope this helps :))
No it is fali i hope this helps you out
Other Questions
What was the Selective Service Act and how did it impact the war? When considering the various resources factors of production which of the following is most likely to represent capital? Find the area. The figure is not to scale You can NOT have an in group without having an out group True False 3 chairs and 4 tables cost rs 7540. if the price of a chair is 220 find the price of table?ans - 7120 two equivalent ratios for 17:5? Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA The table below shows information about how many fans there were at twofootball matches in a local tournament.What is the difference between the number of away fans at the semi-final and atthe final?Semi-finalFinalTotal number of fans250400Ratio of home fansto away fans6:47:3 Follow the constitution and the law even if I disagree with it what power or duty is this listed on Nika rolls an 8-sided cube with faces numbered 1 through 8. Which of the following statements is true? P(even number) = P(odd number) = P(number less than 8) = 1P(the number 9) = 1 Why might Great Britain's colonies have contributed tothe start of Ine Industrial Revolutionin Great Britain? What is irony What are the 3 types of irony and examples of each? Which question is a statistical question?A. How tall is the oak tree?B. How much did the oak tree grow in one year?C. What are the heights of the oak trees in the schoolyard?D. What is the difference in height between the oak tree and the pine tree? HELP FOR MY FINAL PLEASE PLEASE In a random sample of 70 people, it was found that 44 of them were fans of the New York Yankees. What is the margin of error for the true proportion of all individuals who are fans of the New York Yankees? A. 0.0088 B. 0.058 C. 0.063 D. 0.116 E. 0.173 Which sentence is the most formal?A. Hi! Do you have any job openings at your work yet?O B. I would like to apply for the administrative position at yourcompany.C. I think it would be really fun to work at your company.D. Please hiring my person for the open position you got in yourestablishmentLIDT TCS the scrum team is using the KANBAN board to make work visually availible to all. What cannot be inferred from the board You can find Maya Angelou's many poetry volumes in most bookstores. What word or phrase is modified by the prepositional phrase in this sentence? What statements about prisms are always true if the top base is directly above the bottom base? Select all that apply. The lateral faces are rectangles. The bases are congruent. The bases can be any shape. The lateral faces are congruent. What is the function of a claim in an argument evaluating an argument?