Atiker wants to uile a rectangular wall which reasures Ambuy 2.5 m,
achtile measures 16 cm by 10 cm,
How many tiles will he need for the wall?
Tik
2.5 m
10 cm
16 cm

Atiker Wants To Uile A Rectangular Wall Which Reasures Ambuy 2.5 M,achtile Measures 16 Cm By 10 Cm,How

Answers

Answer 1

Answer:

Step-by-step explanation:

There are 100 cm in 1 meter. the dimensions are 400cm by 250cm. depending on which way you turn them, they will fit better. if you take 400 divided by 16, you will have a row of 25 wide and if you divide 250 by 10, you will have a length of 25. you now have 25 rows of 25. 25x25 is 625 tiles.

Hope this helps


Related Questions

4 12. DISCUSS MATHEMATICAL THINKING Recall that a perfect square is a number with integers as its
square roots. Is the product of two perfect squares always a perfect square? Is the quotient of two
perfect squares always a perfect square? Explain your reasoning.
Please help will give Brain liest

Answers

Yes the product of two perfect squares is always a perfect square, But the quotient of two perfect squares is not always a perfect square.

What is perfect square?

A perfect square is a number that can be expressed as the product of an integer multiplied by itself.

Examples of perfect squares include 4 (2*2), 9 (3*3), and 25 (5*5).

What is quotient of a number?

The quotient is the result obtained after performing division of one number by another. It is the number of times that the divisor can be subtracted from the dividend until the remainder is smaller than the divisor.

The product of two perfect squares is always a perfect square because the root of the products is equal to the product of roots as shown below,

let us take the two perfect squares 4 and 9, so the square root of 4*9 is,

[tex]\sqrt{4*9} =\sqrt{4} *\sqrt{9} \ =2*3=6[/tex]

But , the quotient of two perfect squares is a perfect square,

When we divide two perfect squares we are not always going to get a quotient that can be represented as the square of an integer. For example, (36/16) = 9/4 which is not a perfect square.

However, if the numerator and denominator in the quotient are the same perfect square then the quotient will be 1 which is a perfect square.

To learn more about perfect square visit:

https://brainly.com/question/385286

#SPJ1

5. There are 42 teachers who work in a school. On Monday, 29 teachers were present. What percentage of the teachers showed up for work? ​

Answers

Answer:

69%

Step-by-step explanation:

There are 42 teachers who work in a school. On Monday, 29 teachers were present. The percentage of the teachers that showed up for work will be:

= 29 / 42 × 100

= 69%

Answer:

Step-by-step explanation:

In any case where you're asked, "what percentage of A is B?" you can simply divide the number B by the A. The decimal you get is the answer. for example, if you're being asked what percentage 12 is of 25, you just divide 12 by 25 to get 0.48, which translates to 48 percent. in your case, 29/42 is 0.69 (rounded down from 0.6904761905) which equals 69%.

In a case where B is larger than A, you still do the same, only with the addition of the whole number. Ex: what percentage of 25 is 86?

86/25 is 3.44, so your answer is 344%.

Hope this helped :)

What is the general formula for Logarithms?

Answers

The general formula for logarithms is [tex]log_b(x) = y[/tex].

What is a logarithmic function?

A logarithmic function is a type of mathematical function that expresses the power to which a given number (the base) must be raised in order to produce a certain value. It is typically written in the form: [tex]f(x) = log_b(x),[/tex] where b is the base of the logarithm.

The general formula for logarithms is:

[tex]log_b(x) = y[/tex]

This means that b raised to the power of y is equal to x.

Where b is the base of the logarithm, x is the number that we are taking the logarithm of, and y is the result or the logarithm of x to the base b.

Hence, the general formula for logarithms is [tex]log_b(x) = y[/tex].

To learn more about the logarithmic functions, visit:

https://brainly.com/question/13473114

#SPJ4

The general formula for logarithms is [tex]log_b(x)=y[/tex].

What is a logarithmic function?

A logarithmic function is a type of mathematical function that expresses the power to which a given number (the base) must be raised in order to produce a certain value. It is typically written in the form: [tex]f(x)=log_b(x)[/tex] where b is the base of the logarithm.

The general formula for logarithms is:

[tex]log_b(x)=y[/tex]

This means that b raised to the power of y is equal to x.

Where b is the base of the logarithm, x is the number that we are taking the logarithm of, and y is the result or the logarithm of x to the base b.

Hence, the general formula for logarithms is [tex]log_b(x)=y[/tex].

To learn more about the logarithmic functions, visit:

brainly.com/question/13473114

#SPJ4

Help Or Else I wiLl TrOw YoU INto A ToLiet

Answers

Answer:

n o

Step-by-step explanation:

I refuse to help. punish me and put me in the toilet

jk lol

Answer:

i throw u in a toilet

Step-by-step explanation:

now u in a toilet

3y+2=2y-5x into y=mx+b form

Answers

3y + 2 = 2y - 5x

3y - 2y = -5x -2

y = -5x - 2

5/9 (y+3)=40 I need help to solve this it’s in algebra

Answers

Answer:

= 69

Step-by-step explanation:

Combine multiplied terms into a single fraction, Distribute, then Multiply all terms by the same value to eliminate fraction denominators.

1) 5/9 ( y + 3 ) = 40 or 5(y + 3) / 9 = 40

2) 5y + 15 / 9 = 40

3) 9 ( 5y + 15 / 9) = 9 40

The table shows the balances of two bank accounts for 3 months. In what month will the balance of account A be equal to the balance of account B?

Answers

 As per Given data,

The month in which the balance of two bank accounts A is become equal to the balance of account B is 30thmonths,

How to find unknown values?

Unknown variables are used to find the unknown values of the problem using the algebraic expressions.

Month       Account A        Account B

 0                    $ 100                 $ 250  

  1                    $ 125                 $ 270

  2                   $ 150                 $ 290

Clearly

The amount in account A is growing with $25 each month. Thus, the amount in this account in nth month is,

100+25[tex]n[/tex]

The amount in account B is just growing with $20. Thus, the amount in this account in nth month is,

250+20[tex]n[/tex]

x month

balances of two

account becomes equal,

then

100 + 25x =250 + 20x

25x - 20x = 250 - 100

5x = 150

x =30

Therefore, in 30th month balance of account A equal to balance of account B

For more questions on unknown variable here: https://brainly.com/question/22489606

#SPJ4

Q. The table shows the balances of two bank accounts for 3 months. In 30th month will the balance of account A be equal to the balance of account B?

Month       Account A      Account B

   0               $100                $250

    1               $125                 $270

    2              $150                 $290

help pls fast it is urgent​

Answers

Answer:

The volume formula is pi r^2h because it is similar to the formula to the area of a circle with an extra addition of the height variable, since a cylinder is just a circle with depth. The surface area formula is 2pirh +2pi r^2 because it measures the area of both circles as well as the depth. This formula is similar to the circumference formula of a circle.

Step-by-step explanation:

Mark me brainliest pls

What is the measure of ABC?

A 44°
B 88°
C 176°
D 92°

Answers

Answer: C) 44 degrees

Step-by-step explanation:

44

Write an exponential function in the form y=ab^xy=ab x that goes through points (0, 2)(0,2) and (3, 686)(3,686).

Answers

y = a b^x

find the values for a and b :

1- you have the point (0,2)

Substitute 0 for x and 2 for y

2 = a * b ^0
2= a * 1
a= 2

2- you have the point (3,686)

Substitute 3 for x and 686 for y and 2 for a

y = 2 b^x

686 = 2 * b^3

343 = b^3

b = 7

y = 2 * 7^x

Write 63/90 and 30/42 as fraction In simplest form then determine whether the ratio form a proportion

Answers

Answer:

7/10 and 5/7 the ratio does not form a proportion

can someone help me
Identify the slope and y-intercept of the equation below.

-9y = 8x + 27

Answers

Answer:

the y-intercept is 27 sorry thats all i know but i belive the slope would be 9/8

Step-by-step explanation:

Answer:

 

y = m x + b

y= -8/9x -3

Step-by-step explanation:

Kassidy charges a flat rate for mowing yards in her neighborhood, shown on the graph below.

Answers

Answer: Fri: 87.5

Sat: 105

Sun: 52.5

Total: 245

Step-by-step explanation: You multiply each lawn she mowed by 17.5

Find the value of x. Assume that segments that appear to be tangent are tangent.

Answers

Assuming segments that appear to be tangent are tangent, sqrt(277) = x has an estimated value of 16.64331698.

what is Pythagoras theorem ?

The Pythagorean Theorem, often referred as the Mathematics, is the fundamental Euclidean geometry relationship among the three sides of a right triangle. The area of a squares with the equilateral triangles side is the sum of the surfaces of square with the other two sides, according to this rule. The Pythagorean Theorem says that the square that spans a right triangle's hypotenuse opposite the perfect angle equals the sum of the squares that span its sides. It is sometimes written as the generic algebra notation a2 + b2 = c2.

given

14 is tangent to the circle and 9 is a radius, making this a right triangle.

In order to resolve this issue, we can employ the Pythagorean theorem.

a^2 +b^2 =c^2

9^2+14^2 =x^2

81+196 = x^2

277 = x^2

Taking the square root of each side

sqrt(277) = sqrt(x^2)

sqrt(277) =x

Assuming segments that appear to be tangent are tangent, sqrt(277) = x has an estimated value of 16.64331698.

To know more about Pythagorean theorem visit:

https://brainly.com/question/14930619

#SPJ1

What is the product 4y 3 )( 2y^2 3y 5?

Answers

The product for the given polynomial is [tex]8y^5 + 6y^4 + 20y^3.[/tex]

When multiplying two polynomials, it is important to keep track of the exponents of each term. The exponents will determine the degree of the resulting polynomial. To find the product, you multiply each term of the first polynomial by each term of the second polynomial, then combine like terms.

In this case, the first polynomial is 4y^3 and the second polynomial is 2y^2 3y 5. To find the product, you would multiply 4y^3 by 2y^2, 4y^3 by 3y, and 4y^3 by 5. This would give you 8y^5, 12y^4, and 20y^3. Since these are the only terms in the product, you simply add them together to get the final answer of [tex]8y^5 + 6y^4 + 20y^3.[/tex]

Learn more about Polynomials here:

https://brainly.com/question/15702527

#SPJ4

What is the length of the missing leg (in millimeters)

Answers

Answer:6

Step-by-step explanation:

A jacket normally sells for $27.50.it is on sale for 20%what is the new price

Answers

Answer:

$22

Step-by-step explanation:

27.50 20 present off so you get 5.5 substract and u get 22

mrs blackwell put 4 2/3 grams on the scale during a lab in science class. then, she added 2 5/6 grams to the scale. how many grams are on the scale in all

Answers

There are [tex]7\frac{1}2}[/tex] grams on the scale in all once she added 2 5/6 grams to the scale.

What is the International System of Units (SI)?

The International System of Units (SI) is the modern form of the metric system and is the most widely used measurement system in the world. It consists of seven basic units of seven basic quantities.

Length is the meter, mass is the kilogram, time is the second, electric current is the ampere, temperature is the kelvin, amount of matter is the mole, and luminosity is the cand. SI also includes derived units such as Newton (force) and Pascal (pressure), which are combinations of base units. SI is the standard measurement system in most countries around the world and is used in scientific, engineering, and commercial applications.

Given,

initial weight = [tex]4\frac{2}{3} = \frac{14}{3}[/tex]

Final weight = [tex]2\frac{5}{6} = \frac{17}{6}[/tex]

Final weight = [tex]\frac{14}{3} + \frac{17}{6} = \frac{45}{6} = \frac{15}{2} = 7\frac{1}{2}[/tex]

To know more about SI system visit:-

https://brainly.com/question/13501946

#SPJ4

Box A is 12 inches by 18 inches by 24 inches. Box B is 12 inches by 12 inches by 30 inches. How much greater is the volume of Box A? A. 5184 in³ B. 4320 in³ C. 864 in³ D. 576 in³

Answers

Answer: I think it’s D


Which of the costs listed below is not an example of a cost that would be
apportioned?
A. Electricity
B. Regional manager's fuel
C. Warehouse space
D. Office supplies

Answers

Answer: the answer is B

Step-by-step explanation: regional managers fuel

Answer:

B. Regional manager's fuel

Step-by-step explanation:

Just did test

Consider the expression.

2x (x + 3y) +5 (2x - 2)

How many terms does the expression have when simplified completely?

Answers

When given expression 2x (x + 3y) +5 (2x - 2) simplified completely then it would have 4 terms.

Consider given expression.

2x (x + 3y) +5 (2x - 2)

We simplify above expression.

2x (x + 3y) +5 (2x - 2)

= [(2x × x) + (2x × 3y)] + [(5 × 2x) - (5 × 2)]       ......(distributive property)

= [2x² + (2 × 3)xy] + [(5×2)x - 10]               ............(commutative property)

= (2x² + 6xy) + (10x - 10)

= 2x² + 6xy + 10x - 10

= 2x² + 10x + 6xy - 10     ...........(by commutative property of addition)

when given expression simplified completely then it would be,

2x (x + 3y) +5 (2x - 2) = 2x² + 10x + 6xy - 10    

The number of terms in an expression 2x² + 10x + 6xy - 10 are 4

Learn more about an expression here:

https://brainly.com/question/30091997

#SPJ4

Which of the following is a perfect square trinomial?

(A) 5x2 - 5x + 1

(B) 5x2 - 10x + 5

(C) 10x2 - 20x + 5

(D) 25x2 - 20x + 3

(E) 25x2 + 20x + 4

Answers

Answer:

B is the perfect square

Step-by-step explanation:

What is the perimeter of ^AEB? 16.4 ft 18.5 ft 18.7 ft 22.9 ft

Answers

The perimeter of ΔAEB is 18.5 feet.

What is Triangle Proportionality theorem?

A triangle's other two sides are divided in the same proportion if a line drawn parallel to either one of its sides intersects the other two sides at two different spots.

As,  side AB║DF hence we will use Triangle Proportionality theorem to calculate the length of side AE.

Since, AE/AD = EB/ BF

AE/2 = 7.2/8.4

AE = 6.5 feet

So, the perimeter of ΔAEB is

= AE + EB + BE

=6.5+4.2+7.8

=18.5 ft.  

Hence, the perimeter  is 18.5 feet.

Learn more about Triangle Proportionality theorem here:

https://brainly.com/question/9315367

#SPJ1

Which simplified ratio correctly compares 5 meters to 100 centimeters?
A. 5:1
B. 20:1
C. 1:5
D. 1:20

Answers

The simplified ratio that compares 5 meters to 100 centimeters is 5: 1 .Option A

How to determine the ratio

Ratio is simply described as the non equal comparison of two numbers, variables, or events.

It shows how many times a number or variable contains another.

The comparison is also based on size.

From the information given, we have;

5 meter to 100 centimeters

It is important to note that;

100 centimeters = 1 meters

Also, 1 meter= 100 centimeters

5 meters = x centimeters

cross multiply

x = 100(5)

Multiply the values

x = 500 centimeters

Then,

5 meters = 1 meter

Hence, the ratio is 5:1

Learn more about ratio here:

https://brainly.com/question/2328454

#SPJ1

Arjun is hiking from a mountain lodge to a nearby summit. The probability that he will take the longest trail is 59. The odds against Arjun taking the longest trail are _[blank]_.

What odds best complete the sentence?

Enter your answer as “m:n{}^{\prime\prime} where m and n are the smallest integers possible, like this: 3:2

Answers

The odds against Arjun taking the longest trail are 4 : 9 .

How to find the probability ?

The probability that when Arjun is hiking from the mountain lodge to the nearby summit, he takes the longest trail, is 5 / 9.

This means that the odds that Arjun will not take the longest trail, or rather, the odds against him taking the longest trail, will be the difference between 1 and the probability that he takes the longest trail:

= 1 - 5 / 9

= 4 / 9

When given as a ratio, this would be:

=  4 : 9

Find out more on probability at https://brainly.com/question/15188066

#SPJ1

What is the HCF of the polynomials x6 3x4 3x^2 1 and x^3 3x^2 3x 1?

Answers

The HCF of the polynomials x^6 + 3x^4 + 3x^2 + 1 and x^3+3x^2 + 3x + 1 is 1

When we divide the polynomials f(x) / g(x) then we get f(x) = g(x) × q(x) + r(x). Assuming the degree of g(x) > degree of r(x).

If the remainder r(x) is zero, then q(x) is the highest common factor of polynomials.

Here, we have been given two polynomials x^6 + 3x^4 + 3x^2 + 1 and x^3+3x^2 + 3x + 1

Let  f(x) = x^6 + 3x^4 + 3x^2 + 1 and  g(x) = x^3 + 3x^2 + 3x + 1

We can write these polynomials as:

f(x) = x^6 + 3x^4 + 3x^2 + 1

f(x) = (x² + 1)^3

The factors of polynomial  f(x) = x^6 + 3x^4 + 3x^2 + 1: 1 and  (x² + 1)^3

And g(x) = x^3 + 3x^2 + 3x + 1

g(x) = (x + 1)^3

And the factors of g(x) = x^3 + 3x^2 + 3x + 1 : (x + 1)^3 and 1

Therefore, the HCF of the polynomials f(x) and g(x) = 1

Learn more about the polynomial here:

https://brainly.com/question/28936357

#SPJ4

Please someone help me it’s due tomorrow

Answers

Answer:

Step-by-step explanation:

8) D

9) B

yall im thinking A or B but can someone help?​

Answers

It’s B, you go down 3 times from p and went over to the left 4 times and 3+4 =7

can some help me with this question?

Answers

Answer:

i think it's reflection followed by translation

Step-by-step explanation:

Answer:

step 1) glide translation of EFG by one unit to the left and 2 units down

step 2) reflection over the x-axis

Step-by-step explanation:

what is the rate of decay f(x)=(.8)^x

9th grade AP algebra

Answers

The provided function, f(x)=(.8)^x, has a 20% rate of decay.

What is the Rate of decay or growth?

A rise in the resultant quantity for a given quantity is referred to as exponential growth, and a decrease in the resultant quantity for a given quantity is referred to as exponential decay.

given, a function  f(x)=(.8)^x. To calculate the decay rate of this function.

The exponential decay formula aids in determining the exponential drop, which is a rapid reduction over time. To calculate population decay, half-life, radioactivity decay, and other phenomena, one uses the exponential decay formula. F(x) = a (1 - r)x is the general form.

Where

a = the initial amount

1-r is the decay factor

x = time span

from the given expression,

Decay factor = 0.8

That is also equal to 1 - r

1 - r = 0.8

r  =0.2

Thus, rate of decay = r * 100%

rate of decay = 0.2 * 100 = 20%

therefore, The rate of the  of the given function  f(x)=(.8)^x is 20%.

Learn more about the rate of decay here:

https://brainly.com/question/30068164

#SPJ1

Other Questions
What was the Selective Service Act and how did it impact the war? When considering the various resources factors of production which of the following is most likely to represent capital? Find the area. The figure is not to scale You can NOT have an in group without having an out group True False 3 chairs and 4 tables cost rs 7540. if the price of a chair is 220 find the price of table?ans - 7120 two equivalent ratios for 17:5? Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA The table below shows information about how many fans there were at twofootball matches in a local tournament.What is the difference between the number of away fans at the semi-final and atthe final?Semi-finalFinalTotal number of fans250400Ratio of home fansto away fans6:47:3 Follow the constitution and the law even if I disagree with it what power or duty is this listed on Nika rolls an 8-sided cube with faces numbered 1 through 8. Which of the following statements is true? P(even number) = P(odd number) = P(number less than 8) = 1P(the number 9) = 1 Why might Great Britain's colonies have contributed tothe start of Ine Industrial Revolutionin Great Britain? What is irony What are the 3 types of irony and examples of each? Which question is a statistical question?A. How tall is the oak tree?B. How much did the oak tree grow in one year?C. What are the heights of the oak trees in the schoolyard?D. What is the difference in height between the oak tree and the pine tree? HELP FOR MY FINAL PLEASE PLEASE In a random sample of 70 people, it was found that 44 of them were fans of the New York Yankees. What is the margin of error for the true proportion of all individuals who are fans of the New York Yankees? A. 0.0088 B. 0.058 C. 0.063 D. 0.116 E. 0.173 Which sentence is the most formal?A. Hi! Do you have any job openings at your work yet?O B. I would like to apply for the administrative position at yourcompany.C. I think it would be really fun to work at your company.D. Please hiring my person for the open position you got in yourestablishmentLIDT TCS the scrum team is using the KANBAN board to make work visually availible to all. What cannot be inferred from the board You can find Maya Angelou's many poetry volumes in most bookstores. What word or phrase is modified by the prepositional phrase in this sentence? What statements about prisms are always true if the top base is directly above the bottom base? Select all that apply. The lateral faces are rectangles. The bases are congruent. The bases can be any shape. The lateral faces are congruent. What is the function of a claim in an argument evaluating an argument?