correct choice???



bio


Correct Choice???bio

Answers

Answer 1

Answer:

solvent

Explanation:

the solvent is the substance in which the solute dissolves

Answer 2

[tex]▪▪▪▪▪▪▪▪▪▪▪▪▪  {\huge\mathfrak{Answer}}▪▪▪▪▪▪▪▪▪▪▪▪▪▪[/tex]

The Correct choice is :

Solvent


Related Questions

what is the transfer of energy in the form of electromagnetice waves

Answers

Answer: Electromagnetic radiation.

Explanation: The transfer of energy by electromagnetic waves is called electromagnetic radiation. Electromagnetic waves can transfer energy through matter or across empty space.

which high grade, foliated metamorphic rock has visible crystals?

Answers

Answer:

Gneiss

Explanation:

Gneiss forms at the highest pressures and temperatures and has crystals large enough to see with the unaided eye. Gneiss features minerals that have separated into bands of different colors. The bands of colors are what define foliation within gneiss.

Hope this helps! : )

Gneiss crystals are large enough to be seen without magnification. Gneiss has color-banded minerals. Color bands define gneiss foliation.

What is Gneiss?

The metamorphic rock known as gneiss is quite common and can be found all over the world. It is produced when procedures of high temperature and high pressure metamorphism are applied to formations that are made up of rocks that are either igneous or sedimentary in nature.

Gneiss is formed at temperatures and pressures that are higher than those required to make schist. Gneiss almost always has a banded texture that is defined by alternating darker and lighter colored bands and does not have a clear cleavage. Gneiss may also lack a distinct cleavage.

Gneisses are frequently found in the crust of continental shields that formed in the distant past. Gneisses like the Acasta Gneiss are among the oldest rocks on Earth and are classified as Proterozoic.

Learn more abut Gneisses, here:

https://brainly.com/question/22489042

#SPJ5

what are some reasons implicit stereotypes might differ from explicit stereotypes?

Answers

Answer:

Implicit stereotypes are automatically activated and operate indirectly, and thus individuals may not be aware that they possess such beliefs. In contrast, explicit stereotypes are accessible to conscious awareness and are what individuals report when asked about group differences.

Explanation:

Please rate, thank me, have a good day

Implicit stereotypes operate automatically and indirectly, so people may not realize they have them. When asked about group differences, people report explicit stereotypes.

What are stereotypes?

A stereotype is a preconceived notion or combination of traits that many people hold to be indicative of a certain kind of person or object. Stereotypes are traits that society automatically ascribes to particular groups of people in order to categorize them according to factors like age, weight, occupation, skin tone, gender, etc.

Since implicit stereotypes function subtly and automatically, people may not even be aware that they hold such beliefs. Conversely, explicit stereotypes are cognizable and are what people report when questioned about group differences.

Learn more about stereotypes, here:

https://brainly.com/question/2070574

#SPJ2

which muscle cells have desmosomes and gap junctions

Answers

Answer:

Cardiac muscle cells are rectangular-shaped cells connected by regions called intercalated discs. Intercalated discs contain gap junctions and desmosomes.

Explanation:

The muscle cells that have desmosomes and gap junctions are cardiac and smooth muscle cells. The correct option is C.

What is a cardiac cell?

Cardiac cells are the chain of myofibrils and look like a chain of rods. It is of red color. Cardiac muscle cell has three types of gap junction. The two types are sheet desmosomes and spot desmosomes.

The options are attached below.

Thus, the correct option is C. cardiac and smooth muscle cells.

Learn more about cardiac cell

https://brainly.com/question/14005473

#SPJ2

state three items that are absorbed by the plant system ?
where do materials pass in the cell
outline three process absorption help to improve

give a real life scenario of how diffusion occur
what type of molecules do we deal with in osmosis ​

Answers

water, sunlight, oxygen.

cells only keep a small amount of _____ on hand and regenerate it as needed using energy stored in carbohydrates and other molecules.

Answers

Answer:

ATP is your answer

Explanation:

Plz help:
b. Compare dominant and recessive traits –
c. Compare pure and hybrid offspring –

Answers

Answer:

b. What is the difference between dominant and recessive traits? Dominant traits are always expressed when the connected allele is dominant, even if only one copy of the dominant trait exists. Recessive traits are expressed only if both the connected alleles are recessive.

c. In the simplest possible terms, purebreds are the offspring that result from mating between genetically similar parents while hybrids are the offspring that are the result of mating between two genetically dissimilar parents.

Explanation:

Answer:

b. Dominant traits are always expressed when the connected allele is dominant, even if only one copy of the dominant trait exists. Recessive traits are expressed only if both the connected alleles are recessive.

Explanation:

c. purebreds are the offspring that result from mating between genetically similar parents while hybrids are the offspring that are the result of mating between two genetically dissimilar parents.

Glycogen is a complex carbon hydrates found in animals true or false?

Answers

Answer:

true

Explanation:

Explanation:

i think true i think please mark me brainlist thank you

discribe the processes of transcriotion and translation

Answers

Explanation:

Basic Biology

BASIC BIOLOGY

Inspired by life

TRANSCRIPTION AND TRANSLATION

Genes provide information for building proteins. They don’t however directly create proteins. The production of proteins is completed through two processes: transcription and translation.

Transcription and translation take the information in DNA and use it to produce proteins. Transcription uses a strand of DNA as a template to build a molecule called RNA.

The RNA molecule is the link between DNA and the production of proteins. During translation, the RNA molecule created in the transcription process delivers information from the DNA to the protein-building machines.

DNA → RNA → Protein

DNA and RNA are similar molecules and are both built from smaller molecules called nucleotides. Proteins are made from a sequence of amino acids rather than nucleotides. Transcription and translation are the two processes that convert a sequence of nucleotides from DNA into a sequence of amino acids to build the desired protein.

These two processes are essential for life. They are found in all organisms – eukaryotic and prokaryotic. Converting genetic information into proteins has kept life in existence for billions of years.

DNA and RNA

RNA and DNA are very similar molecules. They are both nucleic acids (one of the four molecules of life), they are both built on a foundation of nucleotides and they both contain four nitrogenous bases that pair up.

A strand of DNA contains a chain of connecting nucleotides. Each nucleotide contains a sugar, and a nitrogenous base and a phosphate group. There is a total of four different nitrogenous bases in DNA: adenine (A), thymine (T), guanine (G), and cytosine (C).

A strand of DNA is almost always found bonded to another strand of DNA in a double helix. Two strands of DNA are bonded together by their nitrogenous bases. The bases form what are called ‘base pairs’ where adenine and thymine bond together and guanine and cytosine bond together.

Adenine and thymine are complementary bases and do not bond with the guanine and cytosine. Guanine and cytosine only bond with each other and not adenine or thymine.

There are a couple of key differences between the structure of DNA and RNA molecules. They contain different sugars. DNA has a deoxyribose sugar while RNA has a ribose sugar.

Give me an example of seedless vascular plants...​

Answers

Mosses,Hornworts,Liverworts

Explanation:

Seedless vascular plants embrace ferns,Horsetails and club mosses.

Answer:

mosses,liverworts

Explanation:

whats the answer ugh

Answers

Answer:

Phalanges: long bones

Sternum: flat bone

Vertebrae: Irregular bone

match the pairs-rhizobium-
a)nitrogen fixation
b) bakery products
c) food poisoning​

Answers

Answer:

A

Explanation:

Interpreto la imagen: 1. ¿Qué sensaciones te transmite la
fotografía? 2. ¿en dónde se encuentra el fósil del ser vivo
que se observa en la fotografía? 3. ¿A qué reino de la
naturaleza pertenecía el ser vivo de la fotografía? ¿Por qué?
4. ¿Cómo explicarías a una persona que es la evolución a
partir de esta fotografía? 5. La fotografía muestra un fósil
de cocodrilo de la especie C.Robustus, evidencia
paleontológica que demuestra la existencia de estos
animales desde el triásico y el jurásico en el planeta tierra.
¿Por qué crees que, a una institución como el laboratorio
de Ciencias de la Tierra de Lyon, en Francia, le puede
interesar estudiar un espécimen como este?.

Answers

Answer:

what image

Explanation:

These types of consumer relationships can affect the size of prey and plant populations in a community and determine the places these prey and plant species live. For example, certain plants only grow in steep hillside in a habitat because they are eaten near the stream in the valley, or deer live in the forest to better hide from wolves in the open fields.
a. Parasitism and Commensalism
b. Mutualism and Herbivory
c. Predation and Parasitism
d. Predation and Herbivory

Answers

I think the answer is b because the plant would grow on the side of the land because of mulualiam and that is the spreading of seeds in a plant that was left behind

Which type of fossil can help is understand an organisms activity during its time?

Answers

Probably the footprint

what do the roman numerals in the pedigree diagram represent?

Answers

Answer:

I think it is supposed to be generation so 1st and 2nd generation in this case.

Explanation:

Answer:

Roman Numeral stands for the generation in the family

Explanation:

https://www.cs.cmu.edu/~genetics/units/instructions/instructions-PBA.pdf

Pedigree Analysis

list three ways that organisms use energy

Answers

Answer + Explanation:

Organisms use energy to survive, grow, respond to stimuli, reproduce, and for every type of biological process. The potential energy stored in molecules can be converted to chemical energy, which can ultimately be converted to kinetic energy, enabling an organism to move.

which statement about food production since 1960 is true?

Answers

Answer:

During this time our food production has grown even faster than our population

Explanation:

hope this helps you if it does please mark brainiest

What does costal cartilage connect?

Answers

Answer:

a. Ribs to the sternum

Explanation:

Answer:

Ribs to the sternum

Explanation:

A spacecraft can travel 20km/s how many km can this spacecraft travel in 1 hour?

Answers

Answer:

This spacecraft can travel

[tex]72000km[/tex]

_____ is the process by which energy is stored in inorganic molecules is used to produce carbohydrate food molecules

Answers

Answer:

Chemosynthesis

Chemosynthesis is used to produce food using the chemical energy stored in inorganic molecules.

that is the answer

Photosynthesis is the process by which energy stored in inorganic molecules is used to produce carbohydrate food molecules.

What is photosynthesis?

Photosynthesis is the primary process by which plants, algae, and some bacteria capture and store energy from the sun.

During photosynthesis, light energy is absorbed by pigment molecules in the chloroplasts of plant cells. This energy is then used to convert carbon dioxide (CO2) and water (H2O) into glucose (C6H12O6) and oxygen (O2). The glucose produced during photosynthesis is used by the plant as a source of energy and is also stored as a carbohydrate reserve. The oxygen produced during photosynthesis is released into the atmosphere as a byproduct.

Learn more about photosynthesis, here:

https://brainly.com/question/29764662

#SPJ5

when two strains of bacteria with genotypes abcd and abcd are grown together in the lab, a small number of bacteria with the genotype abcd eventually arise. how does this likely occur?

Answers

Answer:

These enzymes work in two ways. Some are pre-replicative and search the DNA for nucleotides with unusual structures

Explanation:

This happened through a lateral transfer of genes.

We can arrive at this answer because:

Lateral gene transfer is a system for exchanging genetic material between unrelated bacteria.Bacteria are beings that reproduce without the exchange of genetic material, but in some cases, this can be done with the lateral transmission of genes.This transmission can be done through the process of conjugation, translation, or transformation.

The result is that new bacteria are created with a mixture of genes from two unrelated bacteria.

More information:

https://brainly.com/question/848637?referrer=searchResults

Help this is due in an hour….

Answers

Answer:

I'm sure it's A

Explanation:

what hormones are responsible for inducing and regulating labor

Answers

there is one hormone that is responsible for inducing and regulating labor which is Oxytocin

When is the gravity exerted on Earth by the Sun and Moon system the greatest? Why do you say this?

Answers

Answer:

When the Moon is positioned between the Sun and the Earth.

Explanation:

This is because you add both the gravitational pull of the Moon, with the gravitational pull of the sun.

Origina
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTCTTCTT
mRNA:
AAS:
Mutation 1
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGTAACTCATTTCTTCT
mRNA :
AAS:
Mutation 2
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAGTTCATTTCTTCTT
mRNA:
AAS:
Mutation 3
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTTTTCTT
mRNA:
AAS:

Answers

Answer:

y is there so much letters?


Please help




I don't know which one is the answer :(​

Answers

Answer:

I believe that your answer is C.

Explanation:

Keep in mind that Steve is working with crops (wheat specifically) and Devan has helped him repair his machinery so that Steve can harvest the wheat properly.

In recent years, poaching in Africa has declined. Will the decrease of poaching lead to a return of more elephants with tusks in future generations?

Answers

Yes, reducing poaching will help increase the elephant population

A bat is a mammal even though it flies in air. Why?​

Answers

Answer

Bats are true mammals in that they give birth to live young, produce milk to feed their young, have hair, and they are warm-blooded (they can self-regulate their body temperature). ... Bats use their wings to fly, and they often use them to catch their prey, mostly flying insects.

Answer:

Flying Mammals

Explanation:

Bats are true mammals in that they give birth to live young, produce milk to feed their young, have hair, and they are warm-blooded (they can self-regulate their body temperature). Bats are unique among mammals in that they can fly. Even though they can fly, they have mammal characteristics.

plants use the ____________ to make organic molecules.

Answers

The answer is light-independent reactions.
Other Questions
Ang _____________ ay isang publikasyon na nilalatha araw-araw. PLEASE HELP ME A woman has a square garden for strawberry planting.2 of the sides have fencing.The fencing is 40m in length.Find the maximum possible area. According to the Rational Root Theorem, which statement about f(x)=8x34x2+6x+3 is true?Group of answer choicesAny rational root of f(x) is a multiple of 8 divided by a multiple of 3.Any rational root of f(x) is a factor of 8 divided by a factor of 3.Any rational root of f(x) is a multiple of 3 divided by a multiple of 8.Any rational root of f(x) is a factor of 3 divided by a factor of 8. Suppose that a Spotify Premium subscriber downloaded a playlist to their phone but never listened to the songs. They then cancelled their subscription and were disappointed to find out that their songs were no longer available on their phone. The fact that the consumer could only listen to those songs when actively subscribed to the service demonstrates which characteristic that distinguishes products from goods What time is three hours and 30 minutes after 6:30 am a.Are you well socialized? What do you think about your socialization? Express your opinion. What method increased the spread of religion and new ideas between China and Japan in the 500s BCE? war feudalism trade tourism Please answer correctly and Ill give brainliest!!The Fundamental Orders of Connecticut established which political principlein the Connecticut colony?A The English king had final authority over all colonial citizers.B. Slavery and indentured servitude were immoral and legal in thecolonies.C. The colonial government had a duty to protect individual rightsD. Colonial religious leaders should be entrusted with political power The Allegheny mountain region of Virginia was formed between 250 and 280 million years ago. What event mostLikely caused the formation of the Allegheny Mountains?-))A)The collision of two continental plates causing upliftB)The deposition of sedimentary rock over the Allegheny regionC)Continental drift separating two plates to move apart slowlyD)Geologic uplift of magma forming igneous rock that converted tomountainous regions Round 171,936 to the nearest ten thousand Calculate the number of moles of NH3 formed by the reaction of 2 moles of N2 and 2 moles of H2,N2(g) + 3H2(g) forms 2NH3(g) Will mark Brainliest if correct! Thankss 12.642 to the nearest tenth 29.10 to the nearest tenth 2,492 to the nearest tenth 3.44 to the nearest tenth 5,239 to the nearest tenth 89.43 to the nearest tenth Correct answer gets brainiest Grade 4helpppp plsssss!!! Someone plz help me :( Can someone please help! Which telemetry is used for monitoring astronauts in space please help with these question, giving brainliest :) pLS help me with thisss:((((((