Hello I need help if you have sometime will you help me? Thank you :)

Hello I Need Help If You Have Sometime Will You Help Me? Thank You :)

Answers

Answer 1

Answer:

blank 1: 0.54

Blank 2 : 1.08

Blank 3: 0.12

Blank 4 : 1.62

Blank 5: 0.34

Blank 6 : 4.59

Step-by-step explanation:

Answer 2

Answer:

2 row 0.12 0.16 3 row is

Step-by-step explanation:


Related Questions

Help please!!!!!!!!!!!!!!

Answers

Answer:

40 degrees

Step-by-step explanation:

a triangle equalls 180 degrees so you add the two degrees of the angles which equals to 140 degrees and then subtract from 180.This equals 40 degrees.

Find the area of the rectangle.

Answers

a=35/72
explanation:
formula for area is a=lw
a=?
l (length) = 7/8
w (width) = 5/9
multiply.

Select the correct answer.

Answers

Answer: the answer would be 1/8

Step-by-step explanation:

in decimal form it would be 0.125 so the answer is 1/8

hope this helps.

Your answer is going to be 1/8
:))

Which literal equation is not equivalent to x equals two y plus z ?

x minus two times y equals z

x minus z equals two times y

y equals x minus z divided by two

x plus two y equals z

Answers

Answer:

x minus z equals two times y

Step-by-step explanation:

x minus z equals two times yx minus z equals two times yx minus z equals two times yx minus z equals two times yx minus z equals two times yx minus z equals two times yx minus z equals two times yx minus z equals two times yx minus z equals two times yx minus z equals two times yx minus z equals two times yx minus z equals two times yx minus z equals two times yx minus z equals two times yx minus z equals two times yx minus z equals two times yx minus z equals two times yx minus z equals two times yx minus z equals two times y

X minus z equal two times why



Hope this helped

what is 5 divided by 4/9

Answers

The answer is 11 1/4

Answer:

11.25

Step-by-step explanation:

You have to flip the sign and the fraction

5*9/4

45/4

11.25

Smallville is 104 miles east of Bigtown. Medburg is 206 miles east of Bigtown. How many miles is Medburg from Smallville?

Answers

Answer:

102 miles

Step-by-step explanation:

Answer:

102

Step-by-step explanation:

206-104=102

Taylor purchased a 5-inch tall model of the Washington Monument when she visited nation's capital. if the Washington Monument is about 555 feet tall, which scale best represents the scale used for the model that Taylor purchased?

A. 1 inch = 100 feet
B. 1 inch = 105 feet
C. 1 inch = 110 feet
D. 1 inch = 150 feet

Answers

Answer:

the exact is 111 but C is the next best

Step-by-step explanation:

555/5=111

111 is closest to 110

C. The actual is answer is 111 feet, but since it asked which one best represents, 110 is the closest to 111. 555 divided by 5 is 111. So therefore the answer is C.

Trick question what is 1+(6+8)×3? Did you get it correct?
(A) 25
(B) 24
(C) 23
(D) 10




























The answer is...




















Guess! lol

Answers

6+8= 14+1=15 times 3 shouldnt it be45?

Find the product. Round to the nearest hundredth. 23.67 x 2.03

Answers

Answer:

48.1

Step-by-step explanation:

Answer:

Your answer would be 48.05

Step by step explanation:

23.67 × 2.03 = 48.0501

48.0501 = 48.05

Can somebody please help me with these two problems ASAP I’d highly appreciate it.

Answers

Answer: 7

Step-by-step explanation:

See attached picture

Which number line and expression show how to find the distance from 2 to -
5?
O A.
1-2-(-5)
-3
0
1
3 4 5
m
OB.
12-1-5)
O C.
1-2-5

Answers

Answer:

42

Step-by-step explanation:

When should you use the median and interquartile range as your measure of center and measure of variability to compare populations shown on a box plot? Check all that apply.
when there are outliers in the data sets
when there are no big gaps in the middle of the data sets
when the plots representing the data are symmetrical
when the plots representing the data are nonsymmetrical
when there are no outliers in the data set
(yes it IS multiple choice)

Answers

Answer:

1,2,4

Step-by-step explanation:

Had the question before. Hope this helps.

Answer:

A,B,D

Step-by-step explanation:

Just did it

Find the y-intercept of the given function. Write your answer as an ordered pair (x,y) [tex]5x - \frac{2}{3}y = 12[/tex]

Answers

Answer:

y= 3/2(5x-12)

Step-by-step explanation:

hope this helps and if you can mark bainliest :)

To find the Y-intercept.. you’ll need to replace x with 0.. so 5(0)-2/3y=12 then solve for y

What is the value of the missing angle in the triangle?

A) 156 Degrees
B) 66 Degrees
C) 142 Degrees
D) 150 Degrees

Answers

Answer:

A

Step-by-step explanation:

We know that the sum of the interior angles of a triangle must equal 180°. So:

[tex](12)+(12)+x=180[/tex]

Solve for x. Add on the left:

[tex]24+x=180[/tex]

Subtract 24 from both sides:

[tex]x=156\textdegree[/tex]

Our answer is A.

And we're done!

Answer:

A) 156 Degrees

Step-by-step explanation:

All angles in a triangle ALWAYS adds up to 180°.

Step 1: Set up equation

12° + 12° + x° = 180°

Step 2: Solve for x

Combine like terms: x° + 24° = 180°Subtract 24° on both sides: x° = 156°

Step 3: Check

All angles should add up to 180°. Plug it in and check.

156° + 12° + 12° = 180°

156° + 24° = 180°

180° = 180°

Which graph shows the image being rotated 90°?

Answers

Answer:

its A

Step-by-step

C is just a trick one

b can be cancelled cuz it does tot go in the ll quadrant

and D can be cancelled cuz its like a 20 degree turn

Help 100 Points + Brainlyest 8th grade math Look at the pics below

Answers

Answer:Answer:ill help whats the question? can i get brainiest?

Step-by-step explanation:The time taken by car to pass the truck is 1.125 hours

Solution:

A truck enters a highway driving 60 miles per hour a car

The car enters the highway at the same place 9 minutes later and drive 68 miles per hour in the same direction from the time the car enters the highway

Let us first convert 9 minutes to hours

Let the truck covers 'x' m distance in time 't' hour the car will take [t -(3/20)] hour to cover the same distance 'x'

We know that,

For truck : ----------- eqn 1

For car: ------------ eqn 2

From equations (i) and (ii)

Thus the time taken by car to pass the truck is:

Thus the time taken by car to pass the truck is 1.125 hours

Answer

1

PiaDeveau

   Ace

   4.7K answers

   16.8M people helped

Number of miles that marker shows when passes through town= 160 miles.

Number of miles that marker shows currently to John = 115 miles.

We need to find the distance between town and John's current location.

For the problem, we can clearly see that Town is at 160 miles away but when John passes the marker shows 115 miles.

So, it's just the difference between 160 miles and 115 miles.

In order to find that difference, we need to subtract those two numbers.

160miles - 115miles = 45 miles.

So, we could say the distance between town and John's current location is 45 miles.

He'll be able to make 6 shelves.

Step-by-step explanation:

In order to know haw many shelves he can make we need to take the total amount of material and divide it by the amount of material required for each shelve. We have:

total amount = 83 1/2 inches = 83.5 inches

amount per shelve = 12 3/4 inches = 12.75 inches

amount of shelves = total amount/amount per shelve

amount of shelves = 83.5/12.75 = 6.55 shelves

Since he can't make half shelves he'll be able to make 6 shelves and have left over material.

4.5 hours

30 minutes times 9 shelves equals 270

270 minutes translates into 4 and half hours

x=initial deposit amount.

we have to add to the initial deposit amount the incomes and subtract the withdrawal

x+($75.5+$55.25)-($25.15+$18.65)=$210.85

Now we solve this equation.

x+$130.75-$43.8=$210.85

x+$86.95=$210.85

x=$210.85-$86.95

x=$123.9

Step-by-step explanation:

What is the answer of this

Answers

-48 would be the answer

How do you find the unit rate?

Answers

Answer:

A unit rate is a rate with 1 in the denominator. If you have a rate, such as price per some number of items, and the quantity in the denominator is not 1, you can calculate unit rate or price per unit by completing the division operation: numerator divided by denominator.

Step-by-step explanation:

i honestly looked it up hope it helped tho lol

You can calculate the unit rate or the price by doing the division operation . ( numerator divided by denominator )

20pts
If angle JGO is congruent to angle RWI, which angle corresponds to angle i?​

Answers

Answer:

angle O

Step-by-step explanation:

As this is the same corresponding angle

Answer:

angle O

Step-by-step explanation:

Angle O because if you were to draw a triangle and label a point J and R, another angle W and J, the angle remaining would be I and O. So, angle O corresponds with angle I.

What is the next term in the following sequence?
-3, 4, 11, 18,...

27
25
07
11

Answers

25. The pattern is adding 7

Answer:

25

Step-by-step explanation:

the pattern is by 7

-3+7 is 4

4+7 is 11

11+7 is 18

then 18+7 is 25

URGENT: I need these problems answered and steps :/ Will give the first person BRAINLIEST and please show the steps and please please please if you can solve all of these. Thank you soooooo much! :D

1.) - 3/4 x 5/8
2.) - 1/5 x (-2/3)
3.) -81.4 divided by 0.4
4.) -2 1/4 divided by 1 1/2
5.) (-1 1/3)(-2 1/2)
Thank you so much!

Answers

Answer:

1) -15/32

2) 2/15

3) -203.5

4) -3/2 = -1.5

5) 10/3 = 3 1/3

Step-by-step explanation:

For 1, you just multiply the numerators and denominators together (3 by 5, 4 by 8) and then because it is negative, add the negative sign.

For 2, you multiply again, but because there are 2 negative signs, it becomes positive.

For 3, you divide 81.4 by 0.4, you could also divide 814 by 4.

For 4, you keep change flip, so the equation would become -9/4 (-2 1/4=-9/4) and 3/2 would become 2/3. The equation would be (-9/4 * 2/3). Then, you would get -18/12 which is -3/2.

For 5, you just multiply 4/3 by 5/2 which is 20/6 and because 2 negatives, it becomes positive.

1. -15/32

-3/4 TIMES 5/8. So what you are going to do is multiply the bottom number by the top number and remember that a negative times positive equals negative. -3 times 5 equals -15 so that's the top number. Then, do the bottom number and it's 8 times 4, which is 32.

2. 2/15

So you do the same stuff for the last problem but now for this one so -1 times -2 is positive 2 so that's going to be the top number. Then 5 times 3 is 15.

3. -203.5

(-81.4)/0.4. So what you can do is do long division and get -203.5.

4. -1/5

(-2 1/4)/11/2. So what we can do is put the first fraction into improper fractions. So that would be -9/4 DIVIDED by 11/2. So then you're going to multiply 11/2 by 2 and get 22/4. Now we have -9/4 divided by 22/4.

5. 3 1/3

Switch them to improper fractions. -4/3 times -5/2. This will definitely be a positive because of the fact that it's a negative times a negative. This would equal 20/6 which can be simplified to 3 and 1/3.

The snowfall data for Resort A are close to symmetric when they are shown in a box plot. The snowfall data for Resort B are not symmetric when they are shown in a box plot. Why is a box plot a good method to compare the data?

Answers

Answer:

Box and whisker plots are ideal for comparing distributions because the centre, spread and overall range are immediately apparent

Step-by-step explanation:

It is often used in explanatory data analysis

hope this helped

Answer:

When comparing two sets of data, a box plot can show whether either set of data is symmetric. If the data are symmetric, then the mean equals the median. If the data are not symmetric, then the median will be a better measure of center than the mean.

Step-by-step explanation:

what is the surface area of a rectangle prism

Answers

I think the answer is 40 because the rectangles each have a surface area of 8 and 8 times 4 is 32 then the squares have a surface area of 4 and 4 times 2 is 8 and 32+8 gives you the total surface area of 40
Pretty sure it’s 48

Solve the equations in Parts A and B using inverse operations. Check your solutions. In your final answer, include all of
your work
Part A: 5 + 2 = 232 + 13
Part B:5 + 1 = 23% + 13

Answers

Answer:

Part A: 7 = 245

Part B: 6 = 1323/100

Step-by-step explanation:

Part A: Add the numbers 5 and 2 which you get 7 and then you add 232 and 13 which gives you 245

equation version: 5 + 2 = 7

232 + 13 = 245

7 = 245

Part B: In order to convert a precent to a ratio, divide it by 100

23/100

5 + 1 = 23/100 + 13

5 + 1 = 6

23/100 + 13 = 1323/100

6 = 1323/100

Hope this helps :)

Answer: B

Tiesha enjoys reading in her spare time. She reads 4 pages every 1/10 of an hour.
The proportional relationship between the number of pages (p) and the number of hours (h) is represented by the equation
. Write the equation in standard form with a constant of proportionality greater than 1.

Answers

Answer:

p = 40h

Step-by-step explanation:

Answer: p=40h



Explanation I know

9-2x=35
Help Me please

Answers

Answer: x=24

Step-by-step explanation:

Answer: x= -13

Step-by-step explanation: 9-2x=35

subtract 9 from 35 = -2x=26 divide -2 from both sides getting x by itself

26 / -2 = -13 ( x= -13)

What is the answer to 2 subtract 2?

Answers

Answer:

0

Step-by-step explanation:

the answer to 2 subtract 2 is 0

HURY PLEASE!

Laila is setting up a conical tent in the backyard. The height of the tallest part of the tent is 7 feet. The inside of the tent has a volume of 56 cubic feet. How many square feet are covered by the base of the tent?

Answers

Answer:

the answer is not  23.93 ;  it ' s  24 < 3

___________________________________________________________

HAVE A GLORIOUS DAY LUV < 33

___________________________________________________________

brainliest ? :0

                          the crown at the bottom of my answer >.<

Answer:

24

Step-by-step explanation:

I got it right on edg

Which choice shows the numbers correctly ordered?
Please help me I will give out extra points and the brain thing.

Answers

Answer:

I think it's B

Step-by-step explanation:

square root of 1/21 is smallest, then 1/5, then 4.15, then square root of 21

The ansewer is b
The square root of 1/21 means smaller then 1/21 and 1/21 is already the smallest. .20 or 1/5 is the second smallest and 4.5 is less then the square root of 21.

The graph of a proportional relationship contains the point with coordinates (3 , 12). What is the constant of proportionality of the relationship? please help due today and it only allows numerical answers thats all

Answers

Answer:

12/3 or 4

Step-by-step explanation:

When solving for a constant use the equation y/x. All you need to do is find the y coordinate and the x coordinate and divide the 2.

Plugin 12 for y and 3 for x

Other Questions
By finding out who Figaro's parents are how does this inconvenience the Count? Starting from rest, a car travels 18 meters as it accelerates uniformly for 3.0 seconds. What is the magnitude of the car's acceleration? A. 6.0 m/s2 B. 2.0 m/s2 C. 3.0 m/s2 D. 4.0 m/s2 78There are 32 desks in a room.If x represents the number of rows of desks, which expression would equal the number of desks in each row?0 32 + x32 - xO 320 3/x Rafael can type 24 words in 6 minutes. What is his rate in words per minute what happen when two light waves traveling from oppsite direactions meet? if a doctor states that a patient has a bone break in the left anterior portion of their body, lateral to midline in their thoracic cavity, what can you assume im broken? In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services. 275,000 plus 5.4 times 10 to the 5th power Whats a religion ??? Javier has a basket of oranges and apples. The number of oranges is 2 more than twice the number of apples in the basket. The difference of half the number of oranges and half the number of apples is 4.An equation created to find the number of apples Javier has in the basket will have What are all the correct equations factorizar por el motodo de aspas [tex]12x^2 = 3x + 2[/tex] Consider this expression. -3x2- 24x - 36 What expression is equivalent to the given expression? Read the poem. Then, select the correct answerexcerpt adapted fromI Wandered Lonely as a Cloudby William WordsworthI wandered lonely as a cloudThat floats on high o'er vales and hills,When all at once I saw a crowd,A host, of golden daffodils;Beside the lake, beneath the trees,Fluttering and dancing in the breeze,Continuous as the stars that shineAnd twinkle on the milky way.They stretched in never-ending lineAlong the margin of a bayTen thousand sawl at a glance,Tossing their heads in sprightly dance.For oft, when on my couch I lieIn vacant or in pensive moodThey upon that inward eyeWhich is the bliss of solitude:And then my heart with pleasure fills,And dances with the daffodils.Which word best describes the author's tone?Aadmiring.desperateOC somberOD playful \How does the allusion to Ham affect the meaning of the text?It emphasizes Douglass's desire to be free.It allows Douglass to discredit using the Bible to justify slavery.It highlights the similarities between enslaved people and those who enslave them.It compares slavery in the modern world to slavery in Biblical times. Write the definition of a function named count that reads all the strings remaining to be read in standard input and returns their count (that is, how many there are) So if the input was: hooligan sausage economy ruin palatialthe function would return 5 because there are 5 strings there. PLSS HELPP What is the value of x in this equation?4x 2(2x 2) = 2(2x 4)