how do chinese students navigate the cultural and linguistic differences in the british education system and what strategies do they employ to achieve academic success?

Answers

Answer 1

The two nations use different methods to accomplish their educational goals. For instance, British students learn more subjects than Chinese students while Chinese students must attend school for a longer period; the average Chinese class has more than 60 students, which is twice as many as British classes.

What is the British education system?Each of the UK's nations has its own educational system, governed by a different government, making education a devolved issue. The UK's educational system is split into four basic components: elementary education, secondary education, postsecondary education, and higher education. Primary and secondary education, which lasts from from the time a child is five years old until the student is sixteen, is required for children in the UK by law.According to the British curriculum, the standard of learning in the British educational system was significantly higher in elementary and secondary school. Every subject taught at each level is thoroughly understood by the students.

To learn more about british education system, refer to:

https://brainly.com/question/28225666


Related Questions

according to your text, the average police officer is assigned to which duty in a police department?

Answers

The average police officer is typically assigned to patrol duty in a police department.

Patrol duty is considered the backbone of policing and is the most common assignment for police officers in most police departments. Patrol officers are responsible for maintaining public safety and responding to emergency situations.

They patrol designated areas, respond to calls for service, enforce traffic laws, investigate crimes, and arrest suspects as necessary. Patrol officers are the most visible members of a police department and are often the first to respond to a crime or emergency.

To know more about police department, here

brainly.com/question/3706136

#SPJ4

Which television game show was hosted by Groucho Marx?

Answers

"You Bet Your Life" is the name of the game show that Groucho Marx presented on television. It was one of the most well-liked game shows of its time, and it was broadcast on radio and television from 1947 until 1961.

Groucho Marx would enlighten the audience with his sharp wit and funny asides as participants answered questions for a chance to win cash. Marx's comic skills and his capacity to engage the participants in lighthearted and entertaining conversation were a major factor in the show's appeal.

Marx interviewed the contestants, joking around with them in a lighthearted manner, asking them questions, and rewarding them with cash for the right replies. Marx's status as one of the greatest comedians of the 20th century was further cemented by the success of the program during its run.

Learn more about Groucho Marx

https://brainly.com/question/8297471

#SPJ4

The following list describes a certain set of objects in our solar system. No solid surfaces
thick atmospheres
many rings
many moons

Answers

The list describes the characteristics of gas giant planets in our solar system, such as Jupiter, Saturn, Uranus, and Neptune. These planets have no solid surfaces and are composed mainly of hydrogen and helium gas.

They have thick atmospheres consisting of layers of gas and clouds. They also have many rings and a large number of moons.

The list of characteristics provided - no solid surfaces, thick atmospheres, many rings, and many moons - describes the gas giant planets in our solar system: Jupiter, Saturn, Uranus, and Neptune. Unlike the terrestrial planets (Mercury, Venus, Earth, and Mars), the gas giants do not have a solid surface. Instead, their composition consists mostly of gas and ice. The atmospheric pressure on these planets is much higher than on the terrestrial planets, creating thick atmospheres that are mostly made up of hydrogen and helium, with some methane and ammonia. These thick atmospheres create extreme weather conditions on the gas giants, including intense storms and strong winds. The gas giants are also known for their rings, which are made up of ice particles and dust. Saturn has the most well-known and prominent ring system, but all four gas giants have rings. The rings are thought to be the remnants of ancient moons that were destroyed by collisions. Finally, the gas giants have many moons. Jupiter has the most with at least 79, while Saturn has at least 82. Uranus has 27 and Neptune has 14 known moons. These moons are much larger than the moons of the terrestrial planets and have a variety of features, including ice caps and volcanic activity. Some of the moons may even have subsurface oceans that could potentially support life.

In summary, the gas giants in our solar system are unique in their lack of solid surfaces, thick atmospheres, extensive ring systems, and numerous moons.

To know more about solar system please refer: https://brainly.com/question/12075871

#SPJ4

this allows student religious groups to meet in high schools receiving federal funds. it is called____

Answers

The law or provision that allows student religious groups to meet in high schools receiving federal funds is called the Equal Access Act.

The Equal Access Act is a federal law in the United States that was passed in 1984. The law was designed to ensure that students who wished to hold religious meetings or form religious clubs in public secondary schools were allowed to do so without discrimination or censorship.

Under the Equal Access Act, public high schools that receive federal funds must provide equal access to all student groups, regardless of their religious or political beliefs. This means that if a school allows any non-curriculum-related student group to meet on school premises, then it must allow religious student groups to meet as well.

The law also prohibits schools from discriminating against student groups on the basis of their religious or political beliefs. Schools cannot deny recognition or funding to a student group solely because of its religious or political nature.

However, the Equal Access Act does not require schools to sponsor or endorse student groups, or to provide any funding or resources beyond what is provided to other non-curriculum-related student groups. Schools are also allowed to regulate the time, place, and manner of student group meetings, as long as the regulations are applied equally to all groups.

Overall, the Equal Access Act is intended to promote free speech and religious freedom in public high schools, while also ensuring that schools maintain a secular and non-discriminatory environment.

To know more about Equal Access Act here:

https://brainly.com/question/3834031

#SPJ4

every time antonio fails a test he attributes his failure to a lack of sufficient intellogence even though he rarely studies. according to the sociocultural theaory of personality, antonio is experiencing

Answers

According to the sociocultural theory of personality, Antonio is experiencing "learned helplessness" when he attributes his failures to a lack of sufficient intelligence without studying.

Learned helplessness is a psychological theory that explains how people develop beliefs and behaviors that make them feel powerless or unable to act in response to challenging situations. It is an individual's perception that they cannot change their situation, even when they are capable of doing so. For example, when a person is frequently punished for trying something new, they may start to feel like they are incapable of succeeding, even when presented with new opportunities.

Antonio is exhibiting learned helplessness when he attributes his failures to a lack of intelligence without studying. Instead of accepting responsibility for his actions or lack of action, he is placing the blame on an inherent trait, which is not true. By doing this, he is limiting his growth and development because he is not taking the necessary steps to improve his performance.

For more about sociocultural theory:

https://brainly.com/question/30739144

#SPJ11

when people develop explanations of behavior based on things outside the person's control, this is known as a(n)

Answers

When people develop explanations of behavior based on things outside the person's control, this is known as an external attribution.

Attribution refers to the process of explaining the causes of behavior, including one's own behavior or the behavior of others. External attribution occurs when people explain behavior as being caused by factors outside of the individual's control, such as the situation, the environment, or other people.

For example, if someone fails a test and the teacher assumes that it was because the student had a family emergency the night before, the teacher is making an external attribution for the student's performance. In this case, the teacher is assuming that the student's behavior (performing poorly on the test) was caused by factors outside of the student's control (the family emergency), rather than by internal factors such as lack of preparation or motivation.

To know more about external attribution

brainly.com/question/14127461

#SPJ4

after reading chapter 4, which of the cognitive frameworks do you feel best help users determine how to complete a task and activity?

Answers

After reading Chapter 4, the cognitive framework that best helps users determine how to complete a task and activity is the Conceptual Model.

What is the Conceptual Model?

A conceptual model is a representation of a system or event that is abstract and theoretical rather than concrete and tangible. The conceptual model's goal is to present the ideas and concepts that comprise a system or process and how they interrelate. In user interface design, a conceptual model is often employed to help users understand how a particular interface operates and the actions they can take to achieve their objectives.

It assists designers in developing a useful, intuitive, and usable interface. A conceptual model aids in the understanding of the relationships between components of an interface or device. Users benefit from a strong and clear conceptual model because it simplifies the learning curve and improves efficiency.

Learn more about conceptual model: https://brainly.com/question/13235410

#SPJ11

Which actor is a devout Buddhist who studied with the Dalai Lama?A. Johnny DeppB. Richard GereC. Sean PennD. Tom Cruise

Answers

The actor who is a devout Buddhist who studied with the Dalai Lama is Richard Gere. Richard Gere is an American actor and producer who is famous for his roles in a variety of films.

In addition to his career as an actor, he is a devout Buddhist who has studied with the Dalai Lama. Among the other choices of options given in the question are Johnny Depp, Sean Penn, and Tom Cruise. There are a few actors that have taken an interest in Buddhism. Richard Gere is probably the most famous of them. Which actor is a devout Buddhist who studied with the Dalai Lama.

Read more about Buddhist here:https://brainly.com/question/8920497

#SPJ11

which of the following best defines a social movement? group of answer choices a group of people on the fringe of u.s. society a group bent on subverting the government a movement of people a demand by a vast majority of the population to do something a movement that represents the demands of a large segment of the population for political, economic, or social change

Answers

The following option best defines a social movement: "A movement that represents the demands of a large segment of the population for political, economic, or social change."

A social movement is a collective effort by a large group of people who come together to bring about change in society, often related to issues such as politics, economics, or social justice. Social movements are typically characterized by a shared sense of purpose, a desire for change, and a commitment to achieving their goals through nonviolent means. These movements can take many forms, such as protests, marches, boycotts, and other forms of civil disobedience. Ultimately, the goal of a social movement is to bring about meaningful and lasting change in society.

To know more about social movement click here:

brainly.com/question/29913898

#SPJ4

Custodial workers who access the terminal area must have a fingerprint background check done and training in security awareness, unless they are escorted in these areas. T or F

Answers

The given statement is True. In many airports and other secure facilities, custodial workers who require access to restricted areas must undergo a fingerprint background check and receive training in security awareness.

This is to ensure that only authorized personnel are allowed to enter sensitive areas and are aware of the potential security risks associated with their work. In some cases, custodial workers may be allowed access to restricted areas only when escorted by authorized personnel who have undergone security training and background checks.

Custodial workers play a critical role in maintaining the cleanliness and safety of airport terminals and other secure facilities. However, their access to restricted areas also presents a potential security risk, as they may come into contact with sensitive information or equipment that could be used to compromise the facility's security.

To learn more about custodial workers, visit here

https://brainly.com/question/24086627

#SPJ4

OhWhich opinion is not a response to internal

Answers

Answer:Among the things you've provided - the option that doesn't resemble and also isn't a response to an internal stimuli would be wearing sunglasses to protect eyes from UV rays. In all the other cases, the person who does a certain action also gets a feedback from his body which urges him to do that certian action. This isn't the case in D where he sees the sun and knows about the bad UV rays and decides for that course of action.

Explanation:Among the things you've provided - the option that doesn't resemble and also isn't a response to an internal stimuli would be wearing sunglasses to protect eyes from UV rays. In all the other cases, the person who does a certain action also gets a feedback from his body which urges him to do that certian action. This isn't the case in D where he sees the sun and knows about the bad UV rays and decides for that course of action.

What is the importance of intersectionality framework?

Answers

Intersectionality shows us that social identities work on multiple levels, resulting in unique experiences, opportunities, and barriers for each person

which belief system has most shaped culture in afghanistan, pakistan, and bangladesh?

Answers

The belief system that has the most shaped culture in Afghanistan, Pakistan, and Bangladesh is Islam.

Islam is the dominant religion in these countries and has played a significant role in shaping their cultural, social, and political landscape. It has influenced everything from architecture and art to the language and customs of these countries.

Islam has also played a significant role in shaping the political structures of these countries. Many political movements and leaders have drawn inspiration from Islamic teachings and have used Islam to mobilize support for their causes.

Learn more about the belief system

https://brainly.com/question/17972123

#SPJ4

Mexican tetras, or blind cave fish, can see at birth, but their vision later degenerates when skin grows over their eyes.simplecompoundcomplexcompound-complex

Answers

"Mexican tetras, or blind cave fish, can see at birth, but their vision later degenerates when skin grows over their eyes. This is known as compound-complex sentence"

What do you mean by compound complex sentence?

2 or more independ-ent clauses & 1 or more dependent clauses make up a compound complex sentence. A compound-complex sentence is cre-ated when a compound sentence & a complicated sentence are combi-ned to make a complete tho-ught. Although this sentence structure is very com-plex, it can be a very use-ful tool in your writing to assist convey vital de-tails or sub-tlety on a certain issue.

To know more about compound-complex click below:

brainly.com/question/31185819

#SPJ4

believed that the states were responsible for their own debts incurred due to the Revolutionary War and that power should be more balanced between the federal government and the states.

Answers

Answer:

A

Explanation:

what values of international women’s day do you think emmeline possessed?

Answers

Through her participation and leadership in the suffragette movement, Emmeline Pankhurst embodied the principles of International Women's Day, including support for women's rights, gender equality, empowerment.

What main point is being made by Women's Day?

Women and girls must be able to participate, create, study, and work in a secure and productive manner both online and offline, taking use of all opportunities in every area and stage of life, including politics, the economy, society, and education.

What three goals does International Women's Day seek to achieve?

International Women's Day offers a platform for the globe to recognize the accomplishments of women, increase awareness of gender inequality, and strengthen support for women.

To know more about Women's Day visit:-

https://brainly.com/question/30143572

#SPJ1

1. Which foreign policy was the most beneficial (helped us) to the United States? Why?

2. Which foreign policy had the most drawbacks (problems) for the United States? Why?

3. Which foreign policy does the cartoon above represent?
I will give brainliest for the answer that answers all 3 questions.

Answers

Answer: Check below

Explanation:

1. The most beneficial foreign policy to the United States was likely the Good Neighbor Policy, which sought to improve relations between the U.S. and Latin American countries. This policy helped to increase trade and cultural exchange, as well as reduce tensions and conflict in the region. It also helped to improve the image of the U.S. in Latin America and reduce anti-American sentiment.

2. The most problematic foreign policy for the United States was probably the Vietnam War. This policy led to a long and costly conflict that resulted in many American casualties and divided the country. It also damaged the reputation of the U.S. in the world and led to widespread protests and social unrest at home.

3. cartoon above represents Roosevelt's policy of international intervention and involvement, also known as the "Big Stick" policy. The image of the U.S. as a "World Constable" reflects the idea that the U.S. should take an active role in maintaining order and stability in the world, even if it means using force or military intervention. This policy was characterized by a willingness to use military power to protect U.S. interests and assert American influence on the global stage.

When a person experiences oxidative stress, production of ____ in the body is hig

Answers

When a person experiences oxidative stress, the production of reactive oxygen species (ROS) in the body is high. Reactive oxygen species are chemically unstable and highly reactive molecules that are generated during normal cellular metabolism.

They can cause damage to cellular components such as lipids, proteins, and DNA, leading to various diseases such as cancer, neurodegenerative disorders, and cardiovascular diseases.

The body has a natural defense mechanism against ROS called the antioxidant system, which includes enzymes such as superoxide dismutase, catalase, and glutathione peroxidase. These enzymes work to neutralize ROS and prevent them from causing damage. However, when there is an imbalance between the production of ROS and the body's antioxidant defense system, oxidative stress occurs, which can lead to cellular damage and disease.

Oxidative stress can be caused by a variety of factors such as exposure to environmental pollutants, radiation, and certain drugs, as well as lifestyle factors such as smoking, excessive alcohol consumption, and a diet high in processed foods. To reduce the risk of oxidative stress and associated diseases, it is important to maintain a healthy lifestyle, eat a diet rich in antioxidants, and avoid exposure to environmental toxins.

Learn more about oxidative stress here brainly.com/question/28057286

#SPJ4

not conforming to traditional male female norms is called____

Answers

Not conforming to traditional male/female norms is called gender nonconformity.

Gender nonconformity is a broad term that refers to individuals who do not conform to gender roles and expectations based on traditional societal norms.

What is gender nonconformity?

Gender nonconformity refers to an individual who does not conform to the traditional male/female gender roles and expectations that are established by society. This type of behavior usually refers to gender expression, which means the way one presents oneself to the public.

Gender nonconformity isn't synonymous with gender identity or sexual orientation; however, it can be connected to both in various ways.

For example, some people who identify as nonbinary or transgender may exhibit gender nonconforming characteristics, and some lesbian, gay, or bisexual people may show gender nonconforming behaviors.

A few famous gender nonconformists are:

Kristen Stewart and Ruby Rose (Actresses)

Prince and David Bowie (Musicians)

Ellen DeGeneres and Billy Porter (TV Personalities)

To learn more about gender nonconformity, refer below:

https://brainly.com/question/25703837#

#SPJ11

Recommend two ways in which a grade 11 Learner could develop a career portfolio. in each answer also indicate how a career portfolio could help you in choosing a suitable career

Answers

Working portfolios and display portfolios are the two categories of portfolios. Knowing the distinctions between the two is crucial for deciding when to use each.

A job portfolio can assist in demonstrating to potential employers your professional successes, talents, abilities, activities, and attitudes. The career portfolio also functions as a marketing tool by giving prospective employers an idea of how you might perform in the workplace. Portfolio evaluations can be divided into two categories: "instructional" or "working" portfolios and "showcase" portfolios. Formative materials include working or instructional files. They give a student the chance to show that they can carry out a specific talent. The essence of showcase portfolios is summative. Working portfolios and display portfolios are the two categories of portfolios. Knowing the distinctions between the two is crucial for deciding when to use each.

Learn more about marketing here :

https://brainly.com/question/15483550

#SPJ1

acquiring information and transforming it into memory is a. state-dependent learning. b. encoding. c. memory consolidation. d. transfer-appropriate processing.

Answers

Answer:

C

Explanation:

What is one way that everyday citizens can address the problem of plastic waste?

dispose of plastic in a biodegradable way
enact legislation against single-use plastic
create a new policy related to recycling
research the issue online to learn more

Answers

Say no to disposable plastic cutlery, plastic straws and other single-use plastics. Avoid plastics that cannot be recycled if other alternatives exist. Avoid products with excess or unnecessary plastic packaging.

Adopt reusable items such as water bottles, shopping bags, keep cups and travel cutlery

What are the ways to reduce plastic in our daily life?

TIPS FOR REDUCING YOUR PLASTICS CONSUMPTION

Avoid single-use plastics such as drinking straws. ...

If you go shopping, remember to take a cloth bag. ...

Recycle chewing gum... it's also make of plastic! ...

Buy more bulk food and fewer packaged products. ...

Replace plastic Tupperware for glass or steel containers.

learn more about plastic waste here:

https://brainly.com/question/19578788#SPJ1

if after learning about the milgram experiment, we believe that participants who shocked the learner were particularly aggressive people, this is an example of

Answers

If after learning about the Milgram experiment, we believe that participants who shocked the learner were particularly aggressive people, this is an example of the fundamental attribution error.

The abecedarian  criterion error is a cognitive bias that involves  overvaluing the  part of  particular characteristics or dispositional factors in explaining other people.

While  undervaluing the influence of situational factors. In the case of the Milgram  trial, the abecedarian  criterion error would lead us to attribute the actors'  geste

Solely to their  particular characteristics(  similar as aggression), rather than taking into account the situational factors that may have  told  their  conduct(  similar as the authority of the  researcher or the social pressure to misbehave).   In reality, the actors in the Milgram  trial were ordinary people who were put in a  largely stressful and  grueling  situation

           

To know more about  aggressive people  here

https://brainly.com/question/19718882

#SPJ4

a passive leader is one who only shows interest in his/her followers when needed. group starts true or false

Answers

It is TRUE that a passive leader is one who only shows interest in his/her followers when needed.

A passive leader is often described as one who is uninvolved, disengaged, or detached from their followers or the work of the group or organization. They may only show interest or become involved when necessary, and otherwise leave their followers to their own devices.

This style of leadership is generally seen as ineffective, as it can lead to a lack of direction, motivation, and support for followers. Passive leaders may struggle to inspire or engage their followers, and may be perceived as indifferent or uncommitted to the goals and needs of the group.

To know more about passive leader

brainly.com/question/30009304

#SPJ4

after an afternoon watching movies in his apartment, charly pretends to be a cartoon character. he is engaging in:

Answers

After an afternoon watching movies in his apartment, Charly pretending to be a cartoon character is engaging in Fantasy play.

Charly recently engaged in a type of play called Fantasy play. This type of play involves pretending to be someone or something else, often characters from books, movies, and cartoons.

In Charly's case, he pretended to be a cartoon character after watching movies in his apartment in the afternoon. Fantasy play is an important part of childhood development and helps children to think imaginatively and creatively, while also allowing them to develop social skills.

To know more about cartoon , click here.

https://brainly.com/question/24144273

#SPJ4

which of the following theories on intelligence have strong evidential support?have strong evidential supportmultiple intelligencespress space to opencrystallized intelligencepress space to openfluid intelligencepress space to openemotional intelligencepress space to opengeneral intelligence

Answers

Howard Gardner, a Harvard psychologist, put forth the idea of multiple intelligences.

As the most complete and empirically supported theory of cognitive abilities in use today, the Cattell-Horn-Carroll theory has influenced a significant body of research and the continuing improvement of IQ (Intelligence Quotient) tests. (McGrew, 2005). This has sparked the creation of a wide range of psychological theories of intellect that can be divided into four main groups. These classifications include biochemical, cognitive, cognitive-contextual, and psychometric. The idea of fluid and crystallized intelligence was developed by Raymond B. Cattell, who is credited with its creation. However, it is unclear where this idea came from. In various publications, Cattell claimed that it was created in 1940, 1941, or 1942.

Learn more about intelligences here:

https://brainly.com/question/9944825

#SPJ1

compassionate ageism is based on the belief that all older adults: a. want to receive care at home. b. are poor and frail. c. deserve the opportunity to work. d. are capable of making important decisions.

Answers

Compassionate ageism is based on the belief that all older adults deserve the opportunity to work.  (C)

This belief suggests that elderly adults are capable of making important decisions and that they should be given the opportunity to do so.

It also acknowledges that not all older adults are poor and frail, and that some might prefer to receive care at home instead of in a nursing facility.

Furthermore, it highlights the importance of respecting the autonomy of elderly adults and creating an environment where they can live with dignity and independence.(C)

To know more about ageism click on below link:

https://brainly.com/question/11506250#

#SPJ11

A significant part of federal aid to state and local governments goes toward
a. funding social programs.
b. supporting the armed forces stationed there.
c. paying their share of interest on the national debt.
d. maintaining crime labs.

Answers

A significant amount of federal aid to state and local government goes towards funding social programs.

Where does a significant amount of federal aid to state and local government goes towards?

A significant part of federal aid to state and local governments goes towards funding social programs such as Medicaid, education, housing assistance, and food assistance. These programs are designed to provide essential services and support to vulnerable populations and help address social and economic inequalities across the country. While federal aid may also support other programs or services, social programs are often a primary focus of federal aid to state and local governments.

Learn more on federal aid here;

https://brainly.com/question/12486518

#SPJ1

the fact that costa ricans who live in a collectivist society prefer automatic tellers over human tellers is a:

Answers

The fact that costa ricans who live in a collectivist society prefer automatic tellers over human tellers is a cultural paradox.

People alter their cultural norms and practices over time, sometimes completely abandoning them in favor of a different way of thinking or acting. The dynamic tensions that arise when people live in groups are highlighted by this paradoxical view of culture. Individuals, families, regional groups, ethnic groups, socioeconomic classes, political groups, and so on make up societies.

Culture gives a method for peopling to live and cooperate while likewise considering the articulation and execution of particular contrasts. Culture adapts to new circumstances in response to pressures for change rather than breaking down. Culture is adaptable and long-lasting despite the paradoxes that make it appear impossible.

Know more about cultural paradox here

https://brainly.com/question/30450705

#SPJ4

Ok so i need help on this i need this to make sense here it is
PERSUASIVE writing TEMPLATE
Topic/Title
cats or dogs
My Opinion/Point of View
cats are pets like dogs there are more
than those there more breads like dogs to
first argument
dogs are way better than cats
no cats are way better than dogs
how cats are sleepy
yea dogs are to play full
and what if i get lazy
cats just sleep all day and play at nigh
there not playfull thay hurt me
alot wen i try and pet one
yea and dogs bark at night
time wen i'm trying to sleep
Secont Argument
dog food is cheap
at least cat toys is cheap
dog are Expense
Third Argument
cats are cheap there 50$ dogs are 200$ and cats
there low mantnets
so all you need is cat food and litter
yea and dogs are low maintenances to

Answers

My opinion is that cats are pets like dogs, but there are more breeds of cats than there are of dogs.

What is pet?

Pet is an animal kept primarily for a person's company, protection, or entertainment, as opposed to working animals, sport animals, livestock, and laboratory animals, which are kept primarily for performance, agricultural value, or research. Pets provide their owners physical and emotional benefits. Walking a dog can supply both the human and pet with exercise, fresh air, and social interaction.

My first argument is that cats are better than dogs because they are not as active and don't require as much exercise and attention. Cats are also much quieter than dogs, so they don't bark at night when you are trying to sleep. My second argument is that dog food is cheaper than cat toys, but dogs are more expensive than cats because of their higher maintenance needs. My third argument is that cats are cheaper than dogs, usually costing around $50 compared to $200 for dogs, and they require low maintenance. All you need to care for a cat is cat food and litter. Dogs also require low maintenance, but they cost more.

To learn more about pet
https://brainly.com/question/29431124
#SPJ1

Other Questions
If triangle ABC has points A(2, -4) B(-3, 1) C(-2, -6) and you perform the following transformations, where will B' be?Reflection over the y-axis, rotation 90 clockwise, and translation (x + 2, y - 1)B'( , ) One more than two-thirds of a number is no less than 25 During a video about the Mayan civilization, you learn about a bright blue paint pigment that has not faded over time. The chemical composition of this paint pigment has allowed it to withstand not only natural elements, such as sun and rain, but also chemical solvents and acids. What paint did you MOST likely hear about? A. Maya blue B. stucco C. stela D. hieroglyphs you are attempting to interview a 20-year-old patient who brought her two young children with her to the office today she is a single mother who is pregnant with her third child and receives public assistance. how will this response impact your ability to be empathetic? in the context of the net promoter score (nps), which of the following is a difference between promoters and detractors? question 29 options: unlike promoters, detractors are customers who are associated with scores of 7 or 8. unlike promoters, detractors are satisfied customers who may switch to competitors. unlike promoters, detractors defect at higher rates. unlike promoters, detractors are less price sensitive. if you were asked to dissolve a solid into an aqueous solution, how could you speed this process up? how could you slow it down? listed below are a number of possible ways to alter the rate of this process. place them in the proper category. if you need help, think about putting sugar in your tea. items: add the solute in large chunks. add the solute slowly. increase the atmospheric pressure. stir or agitate the solution. if a restriction enzyme that recognizes ggcat and cuts between the two guanine residues is mixed with dna that has the sequence ccgattataatcccgcggcatattagggcgg, how many pieces would the resulting product be? which of the following would most directly interfere with sperm production? which of the following would most directly interfere with sperm production? use of synthetic steroids (testosterone) low sperm count interruption of sustentocytes' production of abp ingestion of a substance that mimicked inhibin How did US and Soviet nuclear arsenals compare? Use the equation in the example to find the number ofcups of water you need if you have 12 cups of flour. when carbonyl compounds are reduced with a reagent such as lialh4 or nabh4 and a new stereogenic center is formed, what will the composition of the product mixture be? 7The United States receives more immigrants than any other nation in the world. However, many countries, like Saudi Arabia and Australia, have a greater percentage of their population made up of immigrants. What does this information reveal about these countries? A. They have smaller populations than that of the United States. B. Their life expectancy is less than in the United States. C. They have more lenient immigration policies than those in the United States. D. They encourage immigrants to move there more than the United States does. why is less atp produced by anaerobic respiration than by aerobic respiration? anaerobic respiration does not make use of an electron transport chain. anaerobic respiration uses a final electron acceptor that is less electronegative than o2, which is used as the final electron acceptor in aerobic respiration. anaerobic respiration does not make use of the citric acid cycle. all of these answers are correct. macy does not like a few of the standard operating procedures adapted for the new project. however, she discussed the items with the team and told them that she realized she was in the minority and that she would adapt the new procedures to maintain smooth operations within the team. which conflict-handling mode did macy use? spicy dish, a large distributor of canned beans and salsa, is organized into four business units: (1) north america salsa, (2) north america legume, (3) latin america, and (4) europe and asia. what two types of departmentalization are illustrated in this example? question 8 options: Describe the cities of the Indus River Valley (Use atleast 3 details):3 4. Myron Security, Inc., had total sales for 1 year of $945,860. Their advertising expenses were $57,370. a. Estimate the percent advertising expenses were of total sales. How do u think readers responded to the William Travis letter with this corrective lens in place, what is her new near point? express your answer with the appropriate units. Write an essay of 400-450 words (2-2 pages) on ONE of the following topics. Write downthe NUMBER and TITLE/HEADING of your essay.The goals left behind