Human activities have caused both acid rain and a global increase in temperature, or global warming. How are these two effects--acid rains and global warming--related to each other? A. Acid rain is a side effect of global warming at the local level B. Acid rain is a side effect of efforts to reduce global warming C. Both acid rain and global warming are caused by the burning of fossil fuels D. Both acid rain and global warming are caused by increased levels of carbon dioxide in the atmosphere

Answers

Answer 1

Answer:

c

Explanation:


Related Questions

These types of consumer relationships can affect the size of prey and plant populations in a community and determine the places these prey and plant species live. For example, certain plants only grow in steep hillside in a habitat because they are eaten near the stream in the valley, or deer live in the forest to better hide from wolves in the open fields.
a. Parasitism and Commensalism
b. Mutualism and Herbivory
c. Predation and Parasitism
d. Predation and Herbivory

Answers

I think the answer is b because the plant would grow on the side of the land because of mulualiam and that is the spreading of seeds in a plant that was left behind

match the pairs-rhizobium-
a)nitrogen fixation
b) bakery products
c) food poisoning​

Answers

Answer:

A

Explanation:

A bat is a mammal even though it flies in air. Why?​

Answers

Answer

Bats are true mammals in that they give birth to live young, produce milk to feed their young, have hair, and they are warm-blooded (they can self-regulate their body temperature). ... Bats use their wings to fly, and they often use them to catch their prey, mostly flying insects.

Answer:

Flying Mammals

Explanation:

Bats are true mammals in that they give birth to live young, produce milk to feed their young, have hair, and they are warm-blooded (they can self-regulate their body temperature). Bats are unique among mammals in that they can fly. Even though they can fly, they have mammal characteristics.

What does costal cartilage connect?

Answers

Answer:

a. Ribs to the sternum

Explanation:

Answer:

Ribs to the sternum

Explanation:

what is the transfer of energy in the form of electromagnetice waves

Answers

Answer: Electromagnetic radiation.

Explanation: The transfer of energy by electromagnetic waves is called electromagnetic radiation. Electromagnetic waves can transfer energy through matter or across empty space.

which high grade, foliated metamorphic rock has visible crystals?

Answers

Answer:

Gneiss

Explanation:

Gneiss forms at the highest pressures and temperatures and has crystals large enough to see with the unaided eye. Gneiss features minerals that have separated into bands of different colors. The bands of colors are what define foliation within gneiss.

Hope this helps! : )

Gneiss crystals are large enough to be seen without magnification. Gneiss has color-banded minerals. Color bands define gneiss foliation.

What is Gneiss?

The metamorphic rock known as gneiss is quite common and can be found all over the world. It is produced when procedures of high temperature and high pressure metamorphism are applied to formations that are made up of rocks that are either igneous or sedimentary in nature.

Gneiss is formed at temperatures and pressures that are higher than those required to make schist. Gneiss almost always has a banded texture that is defined by alternating darker and lighter colored bands and does not have a clear cleavage. Gneiss may also lack a distinct cleavage.

Gneisses are frequently found in the crust of continental shields that formed in the distant past. Gneisses like the Acasta Gneiss are among the oldest rocks on Earth and are classified as Proterozoic.

Learn more abut Gneisses, here:

https://brainly.com/question/22489042

#SPJ5

whats the answer ugh

Answers

Answer:

Phalanges: long bones

Sternum: flat bone

Vertebrae: Irregular bone

state three items that are absorbed by the plant system ?
where do materials pass in the cell
outline three process absorption help to improve

give a real life scenario of how diffusion occur
what type of molecules do we deal with in osmosis ​

Answers

water, sunlight, oxygen.

what are some reasons implicit stereotypes might differ from explicit stereotypes?

Answers

Answer:

Implicit stereotypes are automatically activated and operate indirectly, and thus individuals may not be aware that they possess such beliefs. In contrast, explicit stereotypes are accessible to conscious awareness and are what individuals report when asked about group differences.

Explanation:

Please rate, thank me, have a good day

Implicit stereotypes operate automatically and indirectly, so people may not realize they have them. When asked about group differences, people report explicit stereotypes.

What are stereotypes?

A stereotype is a preconceived notion or combination of traits that many people hold to be indicative of a certain kind of person or object. Stereotypes are traits that society automatically ascribes to particular groups of people in order to categorize them according to factors like age, weight, occupation, skin tone, gender, etc.

Since implicit stereotypes function subtly and automatically, people may not even be aware that they hold such beliefs. Conversely, explicit stereotypes are cognizable and are what people report when questioned about group differences.

Learn more about stereotypes, here:

https://brainly.com/question/2070574

#SPJ2

which statement about food production since 1960 is true?

Answers

Answer:

During this time our food production has grown even faster than our population

Explanation:

hope this helps you if it does please mark brainiest

When is the gravity exerted on Earth by the Sun and Moon system the greatest? Why do you say this?

Answers

Answer:

When the Moon is positioned between the Sun and the Earth.

Explanation:

This is because you add both the gravitational pull of the Moon, with the gravitational pull of the sun.

A spacecraft can travel 20km/s how many km can this spacecraft travel in 1 hour?

Answers

Answer:

This spacecraft can travel

[tex]72000km[/tex]

Which type of fossil can help is understand an organisms activity during its time?

Answers

Probably the footprint

Plz help:
b. Compare dominant and recessive traits –
c. Compare pure and hybrid offspring –

Answers

Answer:

b. What is the difference between dominant and recessive traits? Dominant traits are always expressed when the connected allele is dominant, even if only one copy of the dominant trait exists. Recessive traits are expressed only if both the connected alleles are recessive.

c. In the simplest possible terms, purebreds are the offspring that result from mating between genetically similar parents while hybrids are the offspring that are the result of mating between two genetically dissimilar parents.

Explanation:

Answer:

b. Dominant traits are always expressed when the connected allele is dominant, even if only one copy of the dominant trait exists. Recessive traits are expressed only if both the connected alleles are recessive.

Explanation:

c. purebreds are the offspring that result from mating between genetically similar parents while hybrids are the offspring that are the result of mating between two genetically dissimilar parents.

discribe the processes of transcriotion and translation

Answers

Explanation:

Basic Biology

BASIC BIOLOGY

Inspired by life

TRANSCRIPTION AND TRANSLATION

Genes provide information for building proteins. They don’t however directly create proteins. The production of proteins is completed through two processes: transcription and translation.

Transcription and translation take the information in DNA and use it to produce proteins. Transcription uses a strand of DNA as a template to build a molecule called RNA.

The RNA molecule is the link between DNA and the production of proteins. During translation, the RNA molecule created in the transcription process delivers information from the DNA to the protein-building machines.

DNA → RNA → Protein

DNA and RNA are similar molecules and are both built from smaller molecules called nucleotides. Proteins are made from a sequence of amino acids rather than nucleotides. Transcription and translation are the two processes that convert a sequence of nucleotides from DNA into a sequence of amino acids to build the desired protein.

These two processes are essential for life. They are found in all organisms – eukaryotic and prokaryotic. Converting genetic information into proteins has kept life in existence for billions of years.

DNA and RNA

RNA and DNA are very similar molecules. They are both nucleic acids (one of the four molecules of life), they are both built on a foundation of nucleotides and they both contain four nitrogenous bases that pair up.

A strand of DNA contains a chain of connecting nucleotides. Each nucleotide contains a sugar, and a nitrogenous base and a phosphate group. There is a total of four different nitrogenous bases in DNA: adenine (A), thymine (T), guanine (G), and cytosine (C).

A strand of DNA is almost always found bonded to another strand of DNA in a double helix. Two strands of DNA are bonded together by their nitrogenous bases. The bases form what are called ‘base pairs’ where adenine and thymine bond together and guanine and cytosine bond together.

Adenine and thymine are complementary bases and do not bond with the guanine and cytosine. Guanine and cytosine only bond with each other and not adenine or thymine.

There are a couple of key differences between the structure of DNA and RNA molecules. They contain different sugars. DNA has a deoxyribose sugar while RNA has a ribose sugar.

Glycogen is a complex carbon hydrates found in animals true or false?

Answers

Answer:

true

Explanation:

Explanation:

i think true i think please mark me brainlist thank you

Origina
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTCTTCTT
mRNA:
AAS:
Mutation 1
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGTAACTCATTTCTTCT
mRNA :
AAS:
Mutation 2
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAGTTCATTTCTTCTT
mRNA:
AAS:
Mutation 3
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTTTTCTT
mRNA:
AAS:

Answers

Answer:

y is there so much letters?

what hormones are responsible for inducing and regulating labor

Answers

there is one hormone that is responsible for inducing and regulating labor which is Oxytocin

which muscle cells have desmosomes and gap junctions

Answers

Answer:

Cardiac muscle cells are rectangular-shaped cells connected by regions called intercalated discs. Intercalated discs contain gap junctions and desmosomes.

Explanation:

The muscle cells that have desmosomes and gap junctions are cardiac and smooth muscle cells. The correct option is C.

What is a cardiac cell?

Cardiac cells are the chain of myofibrils and look like a chain of rods. It is of red color. Cardiac muscle cell has three types of gap junction. The two types are sheet desmosomes and spot desmosomes.

The options are attached below.

Thus, the correct option is C. cardiac and smooth muscle cells.

Learn more about cardiac cell

https://brainly.com/question/14005473

#SPJ2

In recent years, poaching in Africa has declined. Will the decrease of poaching lead to a return of more elephants with tusks in future generations?

Answers

Yes, reducing poaching will help increase the elephant population

plants use the ____________ to make organic molecules.

Answers

The answer is light-independent reactions.

Give me an example of seedless vascular plants...​

Answers

Mosses,Hornworts,Liverworts

Explanation:

Seedless vascular plants embrace ferns,Horsetails and club mosses.

Answer:

mosses,liverworts

Explanation:

_____ is the process by which energy is stored in inorganic molecules is used to produce carbohydrate food molecules

Answers

Answer:

Chemosynthesis

Chemosynthesis is used to produce food using the chemical energy stored in inorganic molecules.

that is the answer

Photosynthesis is the process by which energy stored in inorganic molecules is used to produce carbohydrate food molecules.

What is photosynthesis?

Photosynthesis is the primary process by which plants, algae, and some bacteria capture and store energy from the sun.

During photosynthesis, light energy is absorbed by pigment molecules in the chloroplasts of plant cells. This energy is then used to convert carbon dioxide (CO2) and water (H2O) into glucose (C6H12O6) and oxygen (O2). The glucose produced during photosynthesis is used by the plant as a source of energy and is also stored as a carbohydrate reserve. The oxygen produced during photosynthesis is released into the atmosphere as a byproduct.

Learn more about photosynthesis, here:

https://brainly.com/question/29764662

#SPJ5


Please help




I don't know which one is the answer :(​

Answers

Answer:

I believe that your answer is C.

Explanation:

Keep in mind that Steve is working with crops (wheat specifically) and Devan has helped him repair his machinery so that Steve can harvest the wheat properly.

what do the roman numerals in the pedigree diagram represent?

Answers

Answer:

I think it is supposed to be generation so 1st and 2nd generation in this case.

Explanation:

Answer:

Roman Numeral stands for the generation in the family

Explanation:

https://www.cs.cmu.edu/~genetics/units/instructions/instructions-PBA.pdf

Pedigree Analysis

Help this is due in an hour….

Answers

Answer:

I'm sure it's A

Explanation:

cells only keep a small amount of _____ on hand and regenerate it as needed using energy stored in carbohydrates and other molecules.

Answers

Answer:

ATP is your answer

Explanation:

Interpreto la imagen: 1. ¿Qué sensaciones te transmite la
fotografía? 2. ¿en dónde se encuentra el fósil del ser vivo
que se observa en la fotografía? 3. ¿A qué reino de la
naturaleza pertenecía el ser vivo de la fotografía? ¿Por qué?
4. ¿Cómo explicarías a una persona que es la evolución a
partir de esta fotografía? 5. La fotografía muestra un fósil
de cocodrilo de la especie C.Robustus, evidencia
paleontológica que demuestra la existencia de estos
animales desde el triásico y el jurásico en el planeta tierra.
¿Por qué crees que, a una institución como el laboratorio
de Ciencias de la Tierra de Lyon, en Francia, le puede
interesar estudiar un espécimen como este?.

Answers

Answer:

what image

Explanation:

list three ways that organisms use energy

Answers

Answer + Explanation:

Organisms use energy to survive, grow, respond to stimuli, reproduce, and for every type of biological process. The potential energy stored in molecules can be converted to chemical energy, which can ultimately be converted to kinetic energy, enabling an organism to move.

when two strains of bacteria with genotypes abcd and abcd are grown together in the lab, a small number of bacteria with the genotype abcd eventually arise. how does this likely occur?

Answers

Answer:

These enzymes work in two ways. Some are pre-replicative and search the DNA for nucleotides with unusual structures

Explanation:

This happened through a lateral transfer of genes.

We can arrive at this answer because:

Lateral gene transfer is a system for exchanging genetic material between unrelated bacteria.Bacteria are beings that reproduce without the exchange of genetic material, but in some cases, this can be done with the lateral transmission of genes.This transmission can be done through the process of conjugation, translation, or transformation.

The result is that new bacteria are created with a mixture of genes from two unrelated bacteria.

More information:

https://brainly.com/question/848637?referrer=searchResults

Other Questions
need help with number 8 please according to the film, what is the crossover date where renewables and natural gas will begin to produce more power than fossil fuels? 4x - 3 = 5 X=? can anyone tell me please Someone pls help me I will make you brain 17. Which of the following correctly classifies the countries in the table by their level of development? The energy an object has due to its movement or position is called please help need ideas for lab reportCompounds Lab ReportInstructions: In this virtual lab you will build chemical compounds from known elements. Record your hypothesis and compound results in the lab report below. You will submit your completed report to your instructor.Note: If you cannot complete this lab as directed, please contact your instructor for assistance.Name and Title: Include your name, instructor's name, date, and name of lab. Objectives(s): In your own words, what is the purpose of this lab? Hypothesis: In this section, please include the if/then statements you developed during your lab activity. These statements reflect your predicted outcomes for the experiment. Procedure: The materials and procedures are listed in your virtual lab. You do not need to repeat them here. However, you should note if you experienced any errors or other factors that might affect your outcome. Using your summary questions at the end of your virtual lab activity, please clearly define the dependent and independent variables of the experiment. Data: Record the composition of each of your compounds below. Be sure to include the number of atoms for each element. An example has been supplied for you. Compound NameChemical FormulaSodium (Na) AtomsCalcium (Ca) AtomsHydrogen (H) AtomsOxygen (O) AtomsCarbon (C) AtomsChlorine (Cl) AtomsEx: SodiumhypochloriteNaClO100101Conclusion: Your conclusion will include a summary of the lab results and an interpretation of the results. Please answer all questions in complete sentences using your own words.Using two to three sentences, summarize what you investigated and observed in this lab.Why do you believe knowing how elements and compounds react together is essential in everyday matters?Some elements are more "reactive" than other elements; why do you think this is?Choose one of the compounds from the table and explain how you know the numbers of atoms in your formula.Is it possible for two different compounds to be made from the exact same two elements? Why or why not? With a limited number of elements (less than 120 are known), does this mean we also have a small number of compounds or do we have a large number of compounds in this world? which muscle cells have desmosomes and gap junctions mad cow disease serves as an example of how interdependent ________ and ________ are to protein. Shakespeare's work is written in which of the following? A.) Modern EnglishB.) Old EnglishC.) Middle EnglishD.) Portuguese 100 POINTS!!!! Please write at least 3 paragraphs. Where is the velocity negative?EBAG Which type of fossil can help is understand an organisms activity during its time? Help me please i've been stuck on this question for hours. as a cure to the epidemic that spread in the whole country, the department of health released a new drug that is subject for experimentation, supposed that c(t)=2tt+2 (in mg/ml) represents the concentration of a drug in a patient's blood stream in t hours, how concentrated is the drug after 2 hours of administration Can someone help me :(( thank you so so much if u do Saturated and trans fats are always good fats for the body. Question 15 options: True False What is the equation of the line that passes through the point (-8,-7) and has a slope of 1? Read and choose the correct option. First To answer ill mark brainiest Plz HelpRead the text, choices, and question carefully and choose the best option to answer the question.Patricia starts high school in Honduras today, and she is talking on the phone to her 16-year-old friend, Marcos, who is in Miami, USA. Marcos wants to spend the next school year in Honduras.Based on the text and on what you learned in the lesson, what is true? He will have to be there by February when the school year starts. He will have to be there by June when the school year starts. He will have to be there by August when the school year starts. He will have to be there by November when the school year starts. Solve for the variable g+3.42=7.98g = ?