If oxygen was removed from the equation, what chemical would build up?

Answers

Answer 1

Answer:

co2

Explanation:

Hope this helps, have a nice day!

Related Questions

Patients with a specific medical condition have been provided with a new device that helps them manage their condition. The patients will be required to participate in a survey regarding the usefulness of the device. How can the manufacturer be certain that no bias enters into the surveys? Group of answer choices

Answers

Answer:

by providing a toll-free number in case there are questions about the devices.

Explanation:

One of the best ways to make certain that this does not happen is by providing a toll-free number in case there are questions about the devices. Doing so makes sure that the customers are fully aware and understand the device and what it is doing. This prevents the customer from assimilating other benefits that they may experience which have nothing to do with the provided device into the survey and potentially contaminating the data with false feedback.

According to cell theory, which of the following are made of cells? Check all that apply.

- flowers
- rocks
- blood
- water
- bacteria
- sugar
- skin

Answers

Answer:

flowers

blood

bacteria

skin

According to cell theory flowers, blood, bacteria and skin all are made up of cells.

What is cell theory?

The cell theory is a scientific theory that was initially developed in the middle of the nineteenth century, which states that all living organisms are composed of cells, that cells are the fundamental structural/organizational unit of all organisms, and that all cells originate from pre-existing cells.

Knowing that all living things are cells helps us comprehend how they are born, grow, and die. That information helps us understand how new life is produced, why creatures take their forms, how cancer spreads, how diseases can be handled, and more. Cells help us grasp life and death: a living creature is alive, while a dead one is dead.

Therefore, flowers, blood, bacteria and skin all are living things made up of cells.

Learn more about cell theory, here:

https://brainly.com/question/1468725

#SPJ2

*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC

Answers

Answer:

which are the letters with hightlight yellow?

29. If lens A is labeled with 10x and the lens in use on B is labeled with 4x, What would
the total magnification be for the fruit fly you are looking at under the microscope?
a. 4000x
C. 400x
b. 40x
d. 4x

Answers

Answer:

B is the correct answer

Explanation:

4x10=40

What is the primary source of energy in a food change

Answers

Answer:

It is the sun in most ecosystems as the light energy is fixed during photosynthesis and then transferred to other organisms via the food chain.

Explanation:

Concept 2 Multiple Choice (2pts each)
1. Which of the following tems represents the smallest part of an element that still has the properties of that element?
A. Cell
B. Matter
C. Atom
D. Molecule

Answers

Molecule dddddddddddddd

It is a molecule because you can already cross out cell and matter and atom.

HELP PLEASE

Each myofibril is made up of arrays of parallel filaments. The thickbands are called _____ and the thin bands are called _____.

Answers

Answer:

A band , I band

Explanation:

YOURE WELCOMEEE

i need help asap please
15 points

Answers

Answer:yes that is right you got it

Explanation:

Answer:

its D

Explanation:

photosynthesis happens with thy sun

Observing Footprints from the Past
detective"O" (observation) or I (inference)

Answers

Answer:

dfvas

Explanation:

sadvadsssssss

The __________ variable in an experiment is the one that the scientist intentionally changes in an experiment. The _______ variable in an experiment is the one that the scientist measures / observes. Values that are kept the same in an experiment and NOT changed are called _______

Answers

Answer:

idependent#1dependent#2and control variable is #3

Explanation:

The indwpendent variable in an experiment is the one that the scientist intentionally changes in an experiment. The dependent variable in an experiment is the one that the scientist measures / observes. Values that are kept the same in an experiment and NOT changed are called Conttol variable

Help !!!!!!!!!!!!!!!!!!!!!

Answers

Answer: I would say D or the last answer

Explanation:

does fab laundry detergent contain enzymes

Answers

Answer:

yes

Explanation:

almost all detergent has enzymes to help clean

Which has been observed in the study of embryology?

A.Species whose embryos have similar traits rarely have a common ancestor.
B.Species whose embryos have similar traits always have similar body forms as adults.
C.All traits present in early embryos remain throughout development.
D.Some traits in certain embryos disappear as the embryo develops.

Answers

Answer:

D. Some traits in certain embryos disappear as the embryo develops

Explanation:

I don't know how I would explain it, but I can list some of the things that disappear such as... Gill slits, and tails. Hope this helped :D

Answer:

D. Some traits in certain embryos disappear as the embryo develops.

Explanation:

Embryology is the study of embryos. Embryos of different animals such as mammals, birds, fish, reptiles etc. look alike that is they are very similar. Many traits of one type of animal appear in the embryo of another type of animal.

Fungi are able to create reproductive cells that
grow into exact copies of the original fungus. What
is this process called?
O sporulation
O binary fission
Obudding
O mitosis

Answers

Answer:

sporulation

Explanation:

i just did it

I need help for this one

Answers

Answer:

Cl2

Explanation:

Answer: Cl2 Hope this helps!

Explanation:

which organ produces egg in female human body?

Answers

Answer:

ovary

Vagina!!

LoL

Explanation:

Mark me the Brainliest

Answer:

Ovary

Explanation:

Hope it helps

please mark as brainliest if you want

why producing 1 kg of beef requires much more water than growing 1 kg of potatoes?

Answers

Answer:

Meat production requires a much higher amount of water than vegetables. IME state that to produce 1kg of meat requires between 5,000 and 20,000 litres of water whereas to produce 1kg of wheat ...

Explanation:

Answer:

compared to beef vegetables require less water like potatoes it takes 287 litres of water

plz help I will mark you brainlist plz

Answers

Answer:

1. Acid

2. Acid

3. Acid

4. Base

5. Acid

6. Bases

7. acid

8. base

9. acid ( could be both)

10. acid

*Anybody correct me if I'm wrong*

Explanation:

You're enjoying playing with your neighbor's new kittens. You notice than some of them look identical to the mama cat, while others looks different from the mom and from each other. You remember from your science class that traits are inherited from parents. All BUT ONE of these traits is inherited.

Answers

Answer:

The answer is WEIGHT

Explanation:

Which is a role of helpful bacteria?
A)removing nutrients from soil
B)Producing oxygen
C)healing sick animals
D)preventing tooth decay

Answers

D) preventing tooth decay

Answer:

its producing oxygen

Explanation:

do plant cells have DNA ?

Answers

Answer:

Yes

Explanation:

Plant DNA is found in the plant cells nucleus, mitochondria and chloroplasts!

4a. Describe two examples of non-living things that have one or more of these characteristics of
life.

Answers

Answer:

Water and Air

Explanation:

Water and air both are missing cells that living things have.

Some one please help me!!!

Answers

Answer:

time

Explanation:

Answer:

revolution

Explanation:

When an organism consumes other organisms for food they are?

Answers

Answer:

Consumer

Explanation:

Producer An organism that can make its own food

Consumer An organism that obtains energy by feeding on other organisms

herbivores consumers that eat only plants

carnivores consumers that eat only animals

A consumer because they eat other animals

True or false: the landmass built up by the dropping of till by a glacier is called alluvial

Answers

Answer: False

Explanation:

Please Help Assap!!!
Which is a factor that keeps Earth in orbit around the Sun?

the orbital path of the moon

the gravitational pull of the Sun

the continuous motion of the universe

Earth’s changing speed and direction

Answers

Answer:

The gravitational pull of the Sun

Explanation:

Viral DNA that is integrated into a bacterial chromosome is a

Answers

Answer:

Hidden virus.

Explanation:

It will sit in the cell's DNA for a while and then attack.

Which organelle houses the genetic material DNA?

Answers

Answer:

Image result for Which organelle houses the genetic material DNA?

nucleus

The nucleus is a membrane-enclosed organelle, found in most eukaryotic cells, which stores the genetic material (DNA).

Explanation:

Nucleus is the organelle that houses the genetic material DNA.

What do you mean by organelle?

"An organelle is a subcellular structure that has one or more specific jobs to perform in the cell, much like an organ does in the body."

What do you mean by genetic material?

"Any material of plant, animal, microbial or other origin that carries genetic information and that passes it from one generation to the next is called genetic material."

What do you mean by DNA?

"DNA or deoxyribonucleic acid is a long molecule that contains our unique genetic code."

What is called a nucleus?

"A nucleus, as related to genomics, is the membrane-enclosed organelle within a cell that contains the chromosomes. An array of holes, or pores, in the nuclear membrane allows for the selective passage of certain molecules (such as proteins and nucleic acids) into and out of the nucleus."

To know more about organelle, genetic material and DNA here https://brainly.com/question/16653190

#SPJ2

(01.05 LC)
Which of the following is the process used by producers that allows energy to be stored in glucose?
A) Cellular respiration
B) Consumption
C) Decomposition
D) Photosynthesis

Answers

The correct answer is D.

PLEASE HURRY!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

What variable is found on the Y-Axis on the HR diagram?

Answers

Temperature increases to the left

Other Questions

(1) Hong Kong is one of the most densely populated places on Earth: people crowd into tiny living spaces, some with only a bed, a hot plate, and a toilet. (2) The city is made up of more than 200 islands, and there is no more available land to house its people. (3) To solve this land shortage problem, officials have proposed a radical solution: creating a whole new island. (4) The East Lantau Metropolis would be built on land reclaimed from the sea and would house 1.1 million people.(5) A different problem faces the people of Kiribatia nation in the central Pacific Ocean made up of 33 islands (most of which are less than twenty feet above sea level). (6) Because of rising sea levels, some inhabitants have already had to abandon their homes. (7) New islands will have to be built to ensure a safe future for its citizens, because science indicates that Kiribati will go underwater within the century.(8) Artificial islands have been seen as solutions for a number of problems in recent decades. (9) The city of Dubai has been constructing a luxurious palm-tree-shaped series of islands to house hotels. (10) Osaka, Japan, built an island off its coast to relieve its overcrowded airport. (11) The Maldives, Malaysia, and Seoul have all built or have plans to build artificial islands to expand their territory.(12) So, is building artificial islands a good solution for modern-day challenges? (13) Not everyone thinks so. (14) Constructing artificial islands destroys the coral reefs that nourish fisheries and protect the coastline from the impact of waves; it also destabilizes precious coastal ecosystems. (15) Building on unstable dredged sediments also endangers human inhabitants, especially in areas prone to earthquakes.The writer wants to provide relevant support for the claim made in sentences 12 and 13. Which of the following sentences, if added after sentence 13, would most effectively accomplish this goal?A) According to the Australian Bureau of Meteorologys National Tidal Centre, there has been an average sea level rise of 7.3 millimeters a year around low-lying islands like Kiribati in the past few decades.B)A professor of biology at Old Dominion University, Kent Carpenter, notes that poaching of giant clams does more damage to marine ecosystems than island building does.C)Marine biologists contend that the urban sprawl spreading into the oceans inevitably causes havoc for marine organisms and their habitats.Marine biologists contend that the urban sprawl spreading into the oceans inevitably causes havoc for marine organisms and their habitats.D)The government of South Korea expected to have 300,000 residents in the utopian smart city built on the artificial island of Songdo.E)Environmental scientists at Macquarie University in Sydney, Australia, have noted that those building artificial islands can use techniques like silt curtains to help minimize the environmental impact of these projects. Which hint is most useful in determining the meaning of the word compassion?The mayor showed great care and compassion as she spoke to the flood victims.I WILL MAKE YOUR BRAINLESSAn antonym for the word is cruelty.The word compassionate is part of this word's family.Compassion is a noun.A cognate for the word is the Spanish word compasin. Danica is buying a teal Jansport backpack at Kohl's for $45. The backpack is on sale for 15% off. What is the sale price of the backpack? One of the central ideas of the Narrative of the Life of Frederick Douglass is that, in the minds of slave owners, an enslaved person is no better than an animal. In a well-developed response of one paragraph, describe how Douglass develops and supports this central idea, citing specific evidence from the text and exploring how Douglass makes connections between key events and the central idea in your response. Given the equation y = -3x + 6, the slope is What national issue lay behind each of lhe following events: the Missouri Compromise, the Compromise of 1850, and theCivil War?A. the legal voling ageB. America's foreign policyC. the temperance movementD. slavery A photo frame with a mass of 2.8 kg is hung from a nail according to the opposite figure. If we know that the nail is located exactly in the middle of the string and the frame does not touch the wall, how many newton is the tensile strength of the string? I need help with this math task, I don't know if you can do it with a photo or not, but I need the result, thanks!! What is the waythe United States divides government power? Hows youre day going? This question comes with a surprise :) first one to answer Todays logos need to be scalable. Would this have also been true of logos in the early 20th century? No, scalable is a modern requirement for logos. Yes, logos needed to be more flexible in earlier eras. Scalable art only became necessary in the digital age. It was not as important then because media was more limited. What does Weber's Law about 'just noticeable differences' predict about how much someone has to change the brightness of a light before we can notice the difference? a. It depends on how bright the light was in the first place - the brighter it was, the less change is needed before we realize it. b. It depends on how long we have been looking at the light - the longer we have been looking, the more change is needed. c. It is always the same amount - 7 lux. d. It depends on how bright the light was in the first place - the brighter it was, the more change is needed before we realize it. Write a one sentence summary about viruses . hii guys who is current president of india? WILL GIVE BRAINLIESTHow was the agraran skill acquired by those in the Middle Colonles?1)generational practices2)from the Native Americans in the area3)through hands on experience in the Americas4)working in groups to acquire the skills I need to come up with 3 ways to sell just a plain stick to a specific target audience of my choice and use different marketing strategies for each. Then I need to make that into an ad. I already did the first two but can anyone give me ideas for the last. It can't be about dogs. :) hehe thanks NEED HELP ASAP PLEASE If a person walks 1/3 mile in 15 minutes, how far will that person walk in one hour? (ik im dumb dont need to say it.) Which of these statements is an example of Stantons use of figurative language?A) "He has denied her the facilities for obtaining a thorough education"B) "He has compelled her to submit to laws, in the formation of which she had no voice."C) "He has made her, if married, in the eye of the law, civilly dead."D) "In entering upon the great work before us, we anticipate no small amount of misconception, misrepresentation, and ridicule." what cell structure is responsible for translation?