In eukaryotic cells the pre-mRNA undergoes processing. Check the following options that are a type of mRNA processing. 5'G Cap 3' G Cap 3' Poly A tail 5' Poly A tail removal of exons removal of introns

Answers

Answer 1

The options that display the processing of pre-mRNA are: (1)5'G Cap; (3) 3' Poly A tail; (6) removal of introns.

pre-mRNA is the first strand produced right after transcription. It is unprocessed and contains both useful and junk parts. The processing of pre-mRNA is done which makes the fully functional m-RNA which is ready to be translated into protein.

Introns are the part of the genes that are transcribed by the process but are note required for the synthesis of a functional protein. Therefore, they are removed in a process called splicing where the introns are removed and all the exons are joined together.

Therefore the correction answer is options 1, 3 and 6.

To know more about pre-mRNA, here

brainly.com/question/28325669

#SPJ4


Related Questions

which of the following is correct about fermentation? select all that apply. glucose is only partially broken down. pyruvate is the final electron acceptor that completes the redox balance. atp produced is similar to aerobic respiration takes place whether or not oxygen is present.

Answers

The options which are correct about fermentation are: Glucose is only partially broken down. ATP produced is similar to aerobic respiration, Takes place whether or not oxygen is present.

Fermentation is a metabolic process that converts sugar to acids, gases, or alcohol. It is an anaerobic process, meaning that it takes place in the absence of oxygen. The process of fermentation releases energy from the oxidation of organic compounds such as glucose, sucrose, or lactose, by using an organic molecule as a final electron acceptor instead of oxygen.

In fermentation, glucose is only partially broken down, producing a limited amount of ATP. Additionally, the ATP produced is similar to aerobic respiration, and fermentation takes place whether or not oxygen is present.

Pyruvate is not the final electron acceptor that completes the redox balance in fermentation; instead, an organic molecule is used as the final electron acceptor.

For more such questions on fermentation, click on:

https://brainly.com/question/11554005

#SPJ11

which process may affect the evolution of color patterns in poeciliids?

Answers

The evolution of color patterns in poeciliids can be influenced by a variety of processes, including:

Sexual selectionNatural selectionGenetic drift

What are  poeciliids?

Poeciliids are a family of freshwater fish that are commonly known as livebearers because they give birth to live young instead of laying eggs. Poeciliids are found primarily in the Americas, ranging from the southern United States down to Argentina, and they are especially diverse in Central America and the Caribbean.

Poeciliids are small fish, typically reaching only a few inches in length, and they come in a wide range of colors and patterns. Some of the most well-known poeciliids include guppies, mollies, swordtails, and platies, which are popular aquarium fish due to their colorful appearance and ease of care.

Learn about Natural selection here https://brainly.com/question/15577096

#SPJ1

breanna and kevin learned that fossil fuels, such as coal and oil, release energy when they are burned. breanna believes this energy comes from the ancient plants and animals that formed fossil fuels, but kevin says the energy in fossil fuels comes from the sun. explain who is right and why.

Answers

Answer: Breanna is correct.

Explanation: When fossil fuels are burned the ancient plants and animals inside create carbon and all that heat turns water into steam which goes into power turbines to create energy.

after electron transport. which side of the mitochondrion membrane is more positive? group of answer choices inside outside none of the above

Answers

The side of the mitochondrial membrane that is more positive after electron transport is the outside.

The electron transport chain is a series of membrane-bound proteins and organic molecules found in the inner membrane of the mitochondria of aerobic cells that are responsible for generating adenosine triphosphate (ATP).

These proteins and organic molecules transfer electrons from the electron donors to the electron acceptors through a series of oxidation/reduction (redox) reactions. This creates an electrochemical gradient that powers ATP production by oxidative phosphorylation, which is the main way that cells generate ATP.

Therefore, the side of the mitochondrial membrane that is more positive after electron transport is the outside. This is because electrons that are transferred through the electron transport chain end up being donated to oxygen molecules, which creates a large proton gradient across the inner mitochondrial membrane. As a result, the outside of the membrane becomes more positively charged than the inside, which has a more negative charge.

This electrochemical gradient can be used to generate ATP by powering the ATP synthase enzyme, which uses the energy from the gradient to phosphorylate adenosine diphosphate (ADP) to create ATP. The electron transport chain is thus a critical component of cellular respiration, as it generates the majority of the ATP that cells need to perform their functions.

For more such questions on Mitochondrial membrane.

https://brainly.com/question/1602075#

#SPJ11

Scientists investigated the role that beak depth plays in the ability of one species of seed-eating finch to reproduce. The scientists calculated the average beak depth of finches in mating pairs and then observed whether or not the pairs produced at least one offspring that survived to the next season. The data are represented in Figure 1. Percent of Pairs Successfully Producing at Least One Offspring 3 4 5 6 Average Beak Depth of Parents (mm) Figure 1. Beak depth and offspring survival in a species of finch Based on the data in Figure 1, which of the following best describes the concept illustrated? (A) Parental pairs with a specific beak depth had the highest reproductive fitness (B) Parental pairs with a specific beak depth ate the most nutritious seeds. (C) Finches with a certain beak depth rarely find mates. (D) Increasing average beak depth results in increasing finch fitness,

Answers

The concept illustrated in the figure (See Picture) describes parental pairs with a specific beak depth had the highest reproductive fitness. So, option A is correct.

The graph(See Picture) shows that the reproductive fitness is at its peak at a particular beak depth of the parents (5 mm). Increase or decrease in the beak depth beyond the specific depth (5 mm) decreases the reproductive fitness of the parent pairs. Hence, choice A is the best one.

Option D is incorrect in terms of its accuracy. The graph makes it evident that, as the beak depth increases from 0 to 5 mm, reproductive fitness increases, and that, beyond 5 mm, reproductive fitness diminishes for each individual.

To know more about reproductive fitness

brainly.com/question/28939574

#SPJ4

explain what happened to the populations in both environments and why that supports or refutes the claim that yellow color is always an adaptive trait in a yellow environment.

Answers

When the populations were moved to different environments, their numbers increased or decreased, which supports the notion that yellow color is not always an adaptive trait in a yellow environment.

Coloration is one of the most typical and noticeable phenotypic characteristics of animals. As a result, it is frequently used to assess an organism's survival and reproduction performance. According to the background research, green frogs, for example, are yellow in yellow environments and green in green environments. The ability to alter coloration is advantageous for prey animals since it aids in their survival. The populations of yellow and green frogs were transported to different environments to test this claim.

When the yellow frogs were moved to a green environment, their population rose. This supports the claim that yellow coloration is not always an adaptive trait in a yellow environment since the yellow frogs thrived better in a green environment.When the green frogs were moved to a yellow environment, their population decreased. This supports the claim that green coloration is an adaptive trait in a green environment because the green frogs struggled to survive in the yellow environment. In summary, the fact that the populations in both environments increased or decreased supports the notion that yellow color is not always an adaptive trait in a yellow environment.

More on population/environment: https://brainly.com/question/31132046

#SPJ11

Which of the following is a common danger of commercial fishing?
A.An increase in biodiversity

B.Improved water quality

C. An improved human diet

D. An increase in human fatality

Answers

Answer: D

Explanation:

what explains the differences among the four illustrations? is there anything that confirms or contradicts the order in which you arranged the illustrations?

Answers

The differences among the four illustrations are due to the presence of lave and mutation within the population of mice. There is no information that confirms or contradicts the order in which the illustrations are arranged.

The illustrations likely depict a population of mice with varying characteristics, such as fur color, tail length, or other physical features. These differences may be due to genetic mutations that have arisen over time or to the presence of different genetic variations within the population.

Additionally, environmental factors, such as availability of food or predation pressure, may also contribute to differences among the mice. However, without more information, it is not possible to confirm or contradict the order in which the illustrations are arranged, as the order may have been arbitrary or based on some other criteria.

To know more about illustrations, here

brainly.com/question/28298427

#SPJ4

if a restriction enzyme that recognizes ggcat and cuts between the two guanine residues is mixed with dna that has the sequence ccgattataatcccgcggcatattagggcgg, how many pieces would the resulting product be?

Answers

The restriction enzyme that recognizes ggcat and cuts between the two guanine residues is HindIII. When HindIII is mixed with the DNA sequence ccgattataatcccgcggcatattagggcgg, the resulting product would be two pieces.

What are restriction enzymes?

Restriction enzymes are proteins that are used in molecular biology to break down DNA molecules by recognizing specific nucleotide sequences and cleaving them. Restriction enzymes are used in genetic engineering to create recombinant DNA molecules.

How do restriction enzymes work?

Restriction enzymes recognize and bind to specific nucleotide sequences in DNA known as recognition sites. The recognition site is usually a specific palindromic sequence of four to six base pairs. Palindromic means that the nucleotide sequence is identical when read in the forward or backward direction.

Restriction enzymes cut DNA by creating a break in both strands of the DNA helix at specific points relative to the recognition site. This creates "sticky ends" that can be joined to other DNA molecules that have complementary overhanging ends.

The recognition sequence of HindIII is 5' G-A-N-T-C 3' and 3' C-T-N-A-G 5'. When HindIII cuts the DNA sequence ccgattataatcccgcggcatattagggcgg, it will cleave between the two guanine residues (G) in the recognition sequence ggcat, resulting in two fragments:ccgattataatcccgcggcat  |  attagggcgg  (sticky ends are indicated by vertical bars)

To know more about restriction enzyme refer to-

brainly.com/question/29882269#
#SPJ11

tony is diagnosed with acid reflux. this is a condition in which stomach secretions which contain hydrochloric acid or hcl, regurgitate (reflux) out of the stomach and into the esophagus. stomach secretions are very acidic with a ph around 2.0. the acids damage the esophagus and it is felt as heartburn. this painful condition can be treated with over-the-counter (otc) antacids. what do you think these antacids are?

Answers

Weak bases, like sodium bicarbonate (NaHCO3) or calcium carbonate (CaCO3). Antacids reduce heartburn, acid indigestion, sour stomach, and stomach distress by neutralising stomach acid.

A component called simethicone, which aids in gas removal, is also found in several antacids. Aluminum and magnesium are two components found in some antacids that may result in constipation or diarrhoea.

Antacids include, for instance:

Aluminium hydroxide gelCaustia carbonate (Alka-Seltzer, Tums)hydrated magnesium (Milk of Magnesia)Rolaids, Mylanta, Maalox, Gaviscon, and GelusilPepto-Bismol

An antacid should be taken exactly as prescribed by a physician or per the directions on the packaging. To get faster relief while taking the tablets, chew them thoroughly before swallowing. To avoid taking too much or using too many antacids, be sure to adhere to the label's instructions.

Learn more about antacid here:

https://brainly.com/question/11384558

#SPJ1

why is less atp produced by anaerobic respiration than by aerobic respiration? anaerobic respiration does not make use of an electron transport chain. anaerobic respiration uses a final electron acceptor that is less electronegative than o2, which is used as the final electron acceptor in aerobic respiration. anaerobic respiration does not make use of the citric acid cycle. all of these answers are correct.

Answers

Anaerobic respiration produces less ATP than aerobic respiration because anaerobic respiration does not make use of an electron transport chain. The correct answer to the question is "anaerobic respiration does not make use of an electron transport chain."

The electron transport chain is a collection of proteins that transfer electrons from NADH and FADH2 to O2, generating a proton gradient across the inner mitochondrial membrane. This gradient is utilized by ATP synthase to generate ATP in the oxidative phosphorylation process.

An important point to remember is that anaerobic respiration uses a final electron acceptor that is less electronegative than O2, which is used as the final electron acceptor in aerobic respiration. The anaerobic respiration process occurs when there is no oxygen in the body.

This lack of oxygen forces the body to convert glucose to energy through fermentation. The fermentation process generates only two ATP molecules per glucose molecule. This energy production process is significantly lower than what is produced by aerobic respiration, which produces 36 ATP molecules per glucose molecule.

Know more about Anaerobic respiration here:

https://brainly.com/question/13943624

#SPJ11

a molecular clock is best described as what? choose one: a.the rate at which nonsense mutations are acquired within a gene b.the relative accuracy of dna polymerases between two organisms c.the amount of divergence within dna resulting from horizontal gene transfer dna molecule (such as dna) whose sequence can be used to deduce ancestry

Answers

A molecular clock is best described as a DNA molecule (such as DNA) whose sequence can be used to deduce ancestry. Option D is correct.

A molecular clock is a technique that uses the rate of mutations in DNA or protein sequences to estimate the time of divergence between two species. It assumes that the accumulation of mutations in a gene or protein is constant over time and that this rate can be used to estimate how long ago two species diverged from a common ancestor.

Therefore, a DNA molecule with a known rate of mutation can be used as a molecular clock to estimate evolutionary relationships and divergence times between species. It is not related to nonsense mutations, accuracy of DNA polymerases, or horizontal gene transfer. Hence Option D is correct.

To learn more about molecular clock, here

https://brainly.com/question/14352403

#SPJ4

what might happen if there is a missense mutation at a start codon, changing aug to auc?

Answers

If there is a missense mutation at a start codon, changing aug to auc, change that results in different amino acids being encoded at a particular position in the resulting protein.

A missense mutation is a Genetic alteration that causes the protein produced to encode a different amino acid at a specific location. Certain missense mutations change how the resultant protein functions.

A missense mutation is a change in the DNA that causes a different amino acid to be included in the protein's structure. DNA is composed of two strands of the four nucleotides adenine, cytosine, guanine, and thymine on a molecular level. RNA polymerase, an enzyme, converts DNA into messenger RNA (mRNA) before it can be translated into a protein.

Next, this mRNA is codified such that any three nucleotides can represent a specific codon that codes for a particular amino acid or a stop codon that denotes the end of protein synthesis.

Learn more about Mutation;

https://brainly.com/question/29354062

#SPJ4

Please answer the questions in the image.

Answers

Obligate anaerobes are organisms that lack the catalase E-Coli bacteria and superoxide dismutase (SOD) enzymes.

Microorganisms known as obligatory anaerobes are unable to tolerate or survive in the presence of oxygen. For their life, they are reliant on anaerobic (oxygen-free) settings. This is due to the environment that oxygen generates, which is poisonous to these species. Reactive oxygen species (ROS) such superoxide anions Mnin E- Coli, hydrogen peroxide, and hydroxyl radicals are more frequently produced in anaerobic environments. These ROS have the potential to harm cellular building blocks like proteins, lipids, and DNA, which could result in cell death.

In order to protect cells from the destructive effects of reactive oxygen species, the enzymes superoxide dismutase (SOD) and catalase transform ROS into less dangerous molecules. Superoxide anions are changed by SOD into hydrogen peroxide, which catalase then breaks down into water and oxygen. Obligate anaerobes are extremely vulnerable to ROS damage because they lack these enzymes (Cu-Mn).

In Eukaryotic cells Obligate anaerobes can be found in many different settings, such as soil, water, and animal gastrointestinal tracts. They are crucial to numerous ecological processes, including the decomposition of organic materials, nitrogen fixation, and carbon cycling. However, some obligatory anaerobes have a crucial role in medicine because they can infect people with impaired immune systems and contribute to the development of specific diseases.

Learn more about superoxide dismutase here

https://brainly.com/question/30450582

#SPJ1

the cell membrane protects and regulates what enters and leaves the cell. which organ system is most similar to the cell membrane?

Answers

Answer:

The skin

Explanation:

c) Fungi (aerobic)
Nitrogen
Oxygen
Carbon
Taken in:
Let out:
Taken in:
Let out:
Taken in:
Let out:

Answers

Answer:

Nitrogen

Explanation:

Nitrogen is an essential requirement for growth, and the ability to metabolize a wide variety of nitrogen sources enables fungi to colonize different environmental niches and survive nutrient limitations.

a micrograph of matched pairs of human chromosomes can be used to confirm the overall condition of homologous chromosomes in an individual. what is this diagnostic tool called?

Answers

A micrograph of matched pairs of human chromosomes can be used to confirm the overall condition of homologous chromosomes in an individual. what is this diagnostic tool called karyotype.

This diagnostic tool is called a karyotype. A karyotype is an organized profile of an individual's chromosomes, arranged in pairs based on their size, shape, and banding patterns.

It helps to confirm the overall condition of homologous chromosomes and can detect any abnormalities, such as missing or extra chromosomes.

Karyotyping is the process of producing a visual profile of the number and appearance of chromosomes in the cell nuclei of an organism.

A karyotype can be used to identify chromosomal abnormalities such as Down syndrome, Turner syndrome, and Klinefelter syndrome, among others.

For more such questions on karyotype , Visit:

https://brainly.com/question/1327739

#SPJ11

true or false? drink driving is dangerous becuase the alcohol in the driver's body will decrease his reaction speed​

Answers

Answer:

True

Explanation:

Drinking while driving slows a person's reaction time. This makes you more likely to crash.

all of the following characteristics are seen in phylum arthropoda except group of answer choices bilateral symmetry. an open circulatory system. protostome development. a pseudocoelom. three embryonic germ layers.

Answers

Bilateral symmetry is not seen in phylum Arthropoda, as these organisms possess an exoskeleton and typically have a segmented body plan that does not result in bilateral symmetry. Instead, Arthropods typically have radial symmetry, which can be seen in the body of a spider or butterfly.

Other characteristics of Arthropods include an open circulatory system, where the heart pumps hemolymph (the arthropod version of blood) throughout the body, protostome development, which is the development of a digestive system from a hollow blastula, a pseudocoelom, which is a body cavity formed from mesoderm and not lined by epithelium, and three embryonic germ layers, which are endoderm, mesoderm, and ectoderm.

Know more about Bilateral symmetry here

https://brainly.com/question/15970176#

#SPJ11

if you were writing about hylobates agilis and homo neanderthalensis at the same time, would you need to change your abbreviations? why or why not? if you needed to change them, what would the new abbreviations be?

Answers

Yes, you would need to change your abbreviations. The abbreviation for Hylobates agilis is H. agilis, while the abbreviation for Homo neanderthalensis is H. neanderthalensis.

If both species are being discussed in the same document, it is important to differentiate between the two. This can be done by changing the abbreviations so that they are more distinct.

For example, H. agilis could become H. a. and H. neanderthalensis could become H. n. These more distinct abbreviations will serve to avoid confusion and help differentiate which species is being referred to.

Know more about Hylobates agilis here

https://brainly.com/question/8703871#

#SPJ11

POV: you are Zheng He writing to yongle emperor about trade goods what would your letter say?

Someone pls help me this is due tmr

Answers

Answer

Greetings Your Majesty,

I hope this letter finds you well. I am writing to update you on the latest developments in our trade expeditions. As you may know, our voyages have been successful in establishing trade relationships with various kingdoms and empires along our route, and we have acquired many valuable goods that can benefit our empire.

During our recent voyage, we have procured many exotic goods such as spices, textiles, precious stones, and rare animals. The spices we have acquired include pepper, cinnamon, and cloves, which are highly sought after in our empire for their medicinal and culinary properties. We have also obtained a variety of textiles such as silk, cotton, and brocade, which are known for their luxurious quality and intricate designs.

In addition, we have acquired precious stones such as diamonds, rubies, and emeralds, which are highly valued for their beauty and rarity. These stones can be used for ornamental purposes and can also be traded for a considerable profit. Moreover, we have brought back rare animals such as giraffes, zebras, and ostriches, which will be of great interest to the people in our empire.

I am confident that these goods will be of great value to our empire and will help us to establish stronger trade relationships with other kingdoms and empires. I will continue to keep you updated on our progress and look forward to reporting back to you on our next voyage.

Yours faithfully,

Zheng He

spherocytosis is a human blood disorder associated with a defective cytoskeletal protein in the red blood cells (rbcs). what do you suspect is the consequence of such a defect?

Answers

The consequence of a defective cytoskeletal protein in red blood cells (RBCs) is spherocytosis.

Spherocytosis is a type of human blood disorder that is associated with a defective cytoskeletal protein in the RBCs.

Spherocytosis is a type of hemolytic anemia. It is characterized by a deficiency of red blood cells (RBCs) in the bloodstream.

The hallmark of spherocytosis is spherical-shaped RBCs. Because they have a smaller surface area-to-volume ratio than normal RBCs, they are more easily destroyed by the spleen.

The people having spherocytosis, their red blood cells are likely to suffer from hemolysis, that means they break down too quickly.

Insufficient RBCs in the bloodstream can lead to: Shortness of breath, fatigue, yellowing of the skin and eyes (jaundice), inability to exercise.

As a result of a defective cytoskeletal protein in the RBCs, it is suspected that the consequence is spherocytosis, a type of hemolytic anemia that is characterized by a deficiency of RBCs in the bloodstream.

Know more about spherocytosis here:

https://brainly.com/question/25772758

#SPJ11

microfauna (small animals) tend to be better indicators of climate and environmental change because:

Answers

Microfauna (small animals) tend to be better indicators of climate and environmental change because: they can adapt quickly and respond to even minor changes in their surroundings. In addition, they have shorter life cycles, which allows for more rapid evolutionary adaptation.

Microfauna (small animals) tend to be better indicators of climate and environmental change because they are abundant, have large population sizes, and are distributed over a wide range of habitats. They can be found in soil, water, and air, and their diverse life histories and ecological roles allow them to be used as indicators of different environmental conditions.

Microfauna (small animals) are also important because they can be used to monitor and assess the impact of human activities on the environment. For example, changes in the abundance or diversity of certain species of microfauna can be used to detect pollution, habitat loss, or other forms of environmental disturbance.

To learn more about "Microfauna" here:

https://brainly.com/question/2055296#

#SPJ11

What is interspecific competition?
What is direct competition?
If the population of a species increases or decreases, what happens to the species that consumes them?
What is adaptation?
What is a mutation?
What is genetic drift?
Why is genetic variation beneficial?
What is altruistic behavior? Give an example.
How are artificial selection and genetic modification similar?
What is natural selection?
Are organisms able to adapt to their environment quickly?
What was mostly responsible for the “great dying”?

Answers

The competition between members of different species is called interspecific competition.

What is an example of adaptation?

A variation can be underlying, meaning it is an actual piece of the organic entity. Behavioral adaptations can also affect an organism's response to its environment. An illustration of an underlying transformation is the manner in which a few plants have adjusted to life in dry, hot deserts.

An illustration of mutation?

A transformation is a change that happens in our DNA grouping, either because of slip-ups when the DNA is replicated or as the consequence of natural factors, for example, UV light and tobacco smoke.

To know more about species visit :-

https://brainly.com/question/13259455

#SPJ1

Answer:

The competition between members of different species is called interspecific competition.

Explanation:

what type of mutation is huntington disease

Answers

HD is caused by a mutation in the gene for a protein called huntingtin. The defect causes the building blocks of DNA called cytosine, adenine, and guanine (CAG) to repeat many more times than they normally do. Most people have fewer than 27 CAG repeats in their HD gene, so they are not at risk for the disease

Why is it more of a strain on the eyes to read a book for two hours than to watch TV (20 feet away) for two hours?

Answers

Reading requires focusing on small, detailed letters for an extended period of time at a closer distance, reading a book for two hours is more strenuous.

How does the eyes get strained?

Reading a book for two hours can be more of a strain on the eyes than watching TV (20 feet away) for two hours because reading involves focusing on small, detailed letters for an extended period of time at a closer distance. This can cause the eye muscles to become fatigued, leading to eyestrain, headaches, and even blurred vision.

Watching TV from a distance of 20 feet is generally considered to be less strenuous on the eyes because the eyes do not have to work as hard to focus on the images, and there is less need to constantly adjust focus or accommodate for near vision.

Learn more on eye strain here: https://brainly.com/question/10246141

#SPJ1

which of the following would most directly interfere with sperm production? which of the following would most directly interfere with sperm production? use of synthetic steroids (testosterone) low sperm count interruption of sustentocytes' production of abp ingestion of a substance that mimicked inhibin

Answers

The following would most directly interfere with sperm production: b. interruption of sustentocytes production of ABP.

The correct option is b. interruption of sustentocytes' production of ABP

Sustentocytes, or Sertoli cells, are the major supporting cells in the seminiferous tubules of the testes. They are responsible for a variety of functions in the testes, including the production of androgen-binding protein (ABP), which binds testosterone and makes it available to developing sperm for their proper maturation.

ABP is a glycoprotein synthesized and secreted by sustentocytes that binds with high affinity to testosterone and its 5α-dihydro derivative (DHT) in the extracellular fluid, preventing their diffusion into the seminiferous tubule lumen or out of the testis. ABP facilitates the uptake of testosterone and DHT by germ cells and stimulates the spermatogenic process.

Therefore, interruption of sustentocytes production of ABP would most directly interfere with sperm production.

Use of synthetic steroids such as testosterone can increase the level of testosterone in the body and, if abused, may suppress the body's natural production of testosterone, leading to reduced sperm production.

Ingestion of a substance that mimics inhibin, which is a hormone produced by Sertoli cells that suppresses FSH production by the anterior pituitary gland, would also interfere with sperm production.

Finally, low sperm count is not a cause of but rather a result of reduced sperm production.

Therefore, the answer to the question is interruption of sustentocytes production of ABP.

To know more about sustentocytes  refer here:

https://brainly.com/question/29749213#

#SPJ11

Complete Question:

Which of the following would most directly interfere with sperm production?

a.low sperm count

b. interruption of sustentocytes' production of ABP

c. ingestion of a substance that mimicked inhibin

d. use of synthetic steroids (testosterone)

a condition of reduced muscle tension, cortical activity, heart rate, breathing rate, and blood pressure is termed:

Answers

The condition of reduced muscle tension, cortical activity, heart rate, breathing rate, and blood pressure is termed as "Relaxation Response."

The relaxation response is the opposite of the body's stress response, and it's a state of deep rest that enhances the body's ability to heal and recover from stress-related symptoms.

According to Herbert Benson, M.D., who founded Harvard's Mind/Body Medical Institute, "we use the relaxation response to change the fundamental state of our physical and mental functioning, causing a reduction in anxiety, insomnia, and hypertension."

The relaxation response is characterized by the following signs: Reduction in blood pressure, Slow breathing rate, Improved metabolism, Decreased heart rate, Reduced muscle tension, Less perspiration, Better sleep patterns, Enhanced immune function, Lower blood lactate levels and Improved mood.

To know more about Relaxation Response, refer here:

https://brainly.com/question/13834897#

#SPJ11

compare and contradt how the skin, lungs, and kidneyd excrete waste from the body.

Answers

Skin —> The skin has sweat glands that secrete a fluid waste called sweat, which is a pathway for water and ion removal from the body.

Lungs —> The lungs diffuse gaseous wastes, such as carbon dioxide, from the bloodstream as a normal part of respiration.

Kidney —> The kidneys filters the blood containing soluble waste material and eliminates it in the form of urine.

which biogeochemical cycle can be influenced by human activity and cause eutrophication of a local water supply? responses nitrogen cycle nitrogen cycle carbon cycle carbon cycle water cycle water cycle oxygen cycle

Answers

The oxygen cycle is the process by which oxygen is released into the atmosphere and then taken up into plants and animals for respiration. Human activity such as burning fossil fuels can lead to an increase in air pollution which can lead to an increase in nitrogen and phosphorus levels.

These nutrients then enter the water supply and can cause eutrophication. Eutrophication is when excess nutrients stimulate the growth of algae which then consume oxygen from the water and lead to an oxygen decrease in the water supply.

This can lead to a decrease in biodiversity of aquatic species due to the decrease in oxygen levels. Therefore, human activities can influence the oxygen cycle and cause eutrophication.

Know more about Eutrophication here

https://brainly.com/question/13232104#

#SPJ11

Other Questions
Finish the sentence the way Gatsby does, describing Daisy: "She's got an indiscreet voice," I remarked. "It's full of-"a. Loveb. Allurec. Flowersd. Money Which plant uses wind as a way to disperse seeds? A statistics professor plans classes so carefully that the lengths of her classes are uniformly distributed between 50.0 and 52.0 minutes. Find the probability that a given class period runs between 50.5 and 51.0 minutes. why was dakota's existing pricing system inadequate for its current operating environment? develop an activity-based cost system for dakota office products (dop) based on the year 2000 data. calculate the activity cost-driver rate for each dop activity in 2000. using your answer to question 2, calculate the profitability of customer a and customer b. what explains any difference in profitability between the two customers? what are the limitations, if any, to the estimates of the profitability of the two customers? is there any additional information you would like to have to explain the relative profitability of the two customers? assume that dakota applies the analysis done in question 3 to its entire customer base. how could such information help dakota managers increase company profits? suppose that a major customer switched from manually placing all its orders to placing all its orders over the internet site. how should this affect the activity cost-driver rates calculated in question 2? how would the switch affect dakota's profitability? compassionate ageism is based on an underlying belief that all older adults: group of answer choices are poor and frail. are capable of making important decisions. deserve the opportunity to work. want to receive care at home. Profit is defined as total revenue minus total cost. The profit function of a company that manufactures and sells x units of a product is given by P(x) = R(x)-C(x), whereP represents the company's profits, R represents the company's revenue, and C represents the company's cost. If a company sells a calculator for $13, its revenuefunction is R(x) = 13x. The cost of each calculator manufactured is $9. In addition, it renewed its lease on the plant, so its weekly fixed costs are $1240.(a) Determine the profit function. (b) Determine and interpret P(700). Which of the following is most likely to result from high self-esteem?A. Respectful relationshipsOB. Alcohol useOC. Violent relationshipsOD. Higher wages 8. Choose all lengths that are equal to6 feet 12 inches.3 yd 1 ft7 ft7 ft 2 in.2 yd 1 ft1 yd 4 ft 400.0 g of a metal absorbs 10000. j of heat energy and its temperature rises from 20.0 c to 103.0 c. what is the specific heat of the metal?a. 0.301 J/gCb. 0.255 J/gCc.3.32 J/gCd. 0.243 J/gC question meteorologists studying the change in a region's precipitation over a 20-year period are studying the region's . which term best completes the sentence? responses Hello I need help with this HELPPPP (LOOK AT PHOTO) a tuning fork vibrating at 512 hz falls from rest and accelerates at 9.80 m/s2. how far below the point of release is the tuning fork when waves with a frequency of 480 hz reach the release point? take the speed of sound in air to be 340 m/s historical context of achievement of greece Help!!!! Its due at 9:30 tomorrow the ermine is a small animal that lives along riverbanks and in forests. during the spring and summer, it grows a brown coat. it sheds the brown coat during the autumn and grows a white one. this change of color in the ermine's coat allows it to - what is the minimum vertical ceiling height to play indoor volleyball? 3.11 what are cultural traits? question 2 options: serious prohibitions against deviant behavior in a society that result in severe punishment the customs, values, social institutions, art, music, dance, language, and traditions that are part of a society's culture a type of action or behavior that is not approved by the people in a society a reward or punishment for the behavior of an individual by the society when hot loading a helicopter, you should: a. approach and leave as a group. b. approach after making eye contact with the medical team. c. lower iv poles and raise bags overhead. d. approach and leave from the uphill side. What cos is and what Sin is of this triangle