is training a statuory requirment in cold weather area for employees and how?

Answers

Answer 1

Yes, training is a statutory requirement in cold weather areas for employees. Employers are obligated to provide their employees with adequate and sufficient training before assigning them tasks in cold weather regions. The training must include both theoretical and practical components.

The following are some of the areas that employers must cover during employee training:

1. Cold Weather Hazards: Employers must ensure that employees are aware of the hazards associated with working in cold weather. These hazards may include frostbite, hypothermia, and other cold-related illnesses. Employees must also be taught how to recognize the signs and symptoms of these hazards.

2. Protective Equipment: Employees must be provided with appropriate protective equipment such as gloves, hats, and jackets. Employers must ensure that the equipment fits properly and is in good condition.

3. Work Procedures: Employers must teach employees the correct work procedures for working in cold weather. For example, employees must be taught how to take breaks to avoid overexertion and how to dress in layers to stay warm

.4. Emergency Procedures: Employees must be taught emergency procedures in case of cold-related incidents. For example, employees must know how to respond if a co-worker develops hypothermia or frostbite.

Overall, employers must ensure that their employees are adequately trained and prepared to work in cold weather conditions. Failure to do so can lead to accidents, illnesses, and even death.

To learn more about training, visit:

https://brainly.com/question/31117541

#SPJ11


Related Questions

Which of the following terms refers to the u... Chec Which of the following terms refers to the use of a medication approved by the United States Food and Drug Administration (FDA) for an illness different from the originally approved condition?
a) phase IV testing
b) off label prescripting
c) surrogate endpoint
d) patent medication

Answers

Option B is the correct .The use of a medication approved by the United States Food and Drug Administration (FDA) for an illness different from the originally approved condition is the off-label prescribing.

Off-label prescribing refers to the usage of medication for a different purpose than what it was approved for by the Food and Drug Administration (FDA). Medications have to be approved by the FDA to be marketed as safe and effective for treating a specific disease or condition.

However, healthcare providers are allowed to use their medical judgment to prescribe medications for an off-label use, when they believe it would benefit the patient .Hence, option B is the correct answer.

To know more about Food and Drug Administration refer here : brainly.com/question/8700359

#SPJ11

You sold Tesla stock short at $515 per share. Your losses could be limited by placing a
day-order.
limit-sell order.
limit-buy order.
None of the options are correct.
stop-buy order.

Answers

The correct answer is "limit-buy order." Placing a limit-buy order can help limit losses when short selling by specifying the maximum price at which you are willing to buy back the shares to cover your short position.

When selling a stock short, you are essentially borrowing and selling shares that you don't own with the hope of buying them back at a lower price in the future to cover your position. Short selling carries the risk of unlimited losses if the stock price rises significantly.

To limit potential losses, you can use a limit-buy order. This order allows you to set a specific price at which you are willing to buy back the shares to close your short position. By setting a limit-buy order, you ensure that you only buy back the shares at or below your specified price, thereby limiting your losses.

For example, if you sold Tesla stock short at $515 per share, you can place a limit-buy order at a price that you believe is acceptable for closing your position. If the stock price reaches or falls below your specified price, the order will be executed, allowing you to buy back the shares and limit your losses. However, if the stock price remains above your limit price, the order will not be filled, and you can reassess your strategy.

Learn more about stock price here:-

https://brainly.com/question/29362234

#SPJ11

J Corp. reported the following: Units: 529 Sales $7403 Variable Costs $512 Fixed Costs $329 If the company reduces its selling price by S8 per unit to generate more sales AND expects the number of units sold to increase by 122 units, what would be the impact to net income? Round ONLY your final answer to 2 decimal places. Do not round intermediate computations. Note decreases as a negative number J Corp. reported the following: Units: 446 Sales $1545 Variable Costs $466 Fixed Costs $421 If the company eliminates sales comissions of $7 per unit by changing to a flat salary increase of $4872 for its sales managers, by what dollar amount would net income change? Round ONLY your final answer to 2 decimal places. Do not round intermediate computations. Note decreases as a negative number

Answers

The impact on net income after reducing the selling price and increasing the units sold would result in a decrease of $44,642,622, while the impact of eliminating sales commissions and changing to a flat salary increase would lead to a decrease of $207,242.

To calculate the impact on net income in both scenarios, we need to compare the original net income with the net income after the changes.

Impact of reducing selling price and increasing units sold:

Original net income can be calculated as follows:

Original Net Income = Sales - Variable Costs - Fixed Costs

Given:

Units: 529

Sales: $7403

Variable Costs: $512

Fixed Costs: $329

Original Net Income = $7403 - $512 - $329 = $6562

After reducing the selling price by $8 per unit and increasing units sold by 122:

New Sales = (529 + 122) * (7403 - 8) = 6511 * 7395 = $48026445

New Variable Costs = (529 + 122) * 512 = 6511 * 512 = $3332032

New Net Income = New Sales - New Variable Costs - Fixed Costs

New Net Income = $48026445 - $3332032 - $329 = $44649184

Impact on Net Income = New Net Income - Original Net Income

Impact on Net Income = $44649184 - $6562 = $44642622 (rounded to 2 decimal places)

Therefore, the impact on net income after reducing the selling price and increasing the units sold would be a decrease of $44,642,622.

Impact of eliminating sales commissions and changing to a flat salary increase:

Original Net Income can be calculated as follows:

Original Net Income = Sales - Variable Costs - Fixed Costs

Given:

Units: 446

Sales: $1545

Variable Costs: $466

Fixed Costs: $421

Original Net Income = $1545 - $466 - $421 = $658

After eliminating sales commissions and changing to a flat salary increase:

New Variable Costs = 446 * 466 = $207836

New Fixed Costs = $421 + $4872 = $5293

New Net Income = Sales - New Variable Costs - New Fixed Costs

New Net Income = $1545 - $207836 - $5293 = -$206584

Impact on Net Income = New Net Income - Original Net Income

Impact on Net Income = -$206584 - $658 = -$207242

Therefore, the impact on net income after eliminating sales commissions and changing to a flat salary increase would be a decrease of $207,242.

To learn more about net income

https://brainly.com/question/28390284

#SPJ11

An example of a nominal variable is ________.
a. the chain weighted measure of GDP
b. production measured at base year prices
c. income measured at current market prices
d. expenditures in terms of th

Answers

Nominal variables are used to define categories, and the data obtained is qualitative rather than quantitative. The term nominal variable is used in statistics and research.

The variable can only be divided into two categories, such as "Yes" or "No." An example of a nominal variable is the production of a factory.What is a nominal variable?A nominal variable is a variable that represents discrete categories or levels that cannot be ranked or compared with one another.

The variable can only be divided into two categories, such as "Yes" or "No." nominal variables are qualitative in nature and can be divided into binary groups. An example of a nominal variable is a person's marital status, which can be "single," "married," "divorced," or "widowed." Another example of a nominal variable is a person's favorite color, which can be "blue," "green," "red," or "yellow."Therefore, option D is the correct answer, i.e., "expenditures in terms of th" since it is a nominal variable.

To know more about quantitative visit:

brainly.com/question/32236127

#SPJ11

Matt plays Lacrosse. His coach expects him to score 3 goals per game. Matt played in 4 games this last month and scored 4 goals total. His productivity ratio per game for the month was: 1 3 33% 25 4

Answers

Matt is expected to score three goals per game while playing lacrosse. Last month, he played four games and scored a total of four goals.

To find out his productivity ratio per game for the month, we need to divide the total number of goals he scored by the total number of games he played. Then we can multiply by 100 to get a percentage . So, the productivity ratio per game for the month is:4 goals / 4 games = 1 goal per game1 goal per game is less than the expected amount of 3 goals per game.

To get the percentage of how productive Matt was compared to what was expected, we can take the productivity ratio per game (1) and divide it by the expected amount of goals per game (3). Then we can multiply by 100 to get a percentage.(1 goal per game / 3 goals per game) x 100% = 33.33%So Matt's productivity ratio per game for the month was 1 goal per game, and he was 33.33% productive compared to what was expected of him.

To know more about game visit:

https://brainly.com/question/32185466

#SPJ11

Monroe County is putting a needle exchange program in place to
stop the spread of HIV and hepatitis C. How would you devise a
system for developing evidence of the effectiveness of this
program?

Answers

The needle exchange program is meant to stop the spread of HIV and hepatitis C in Monroe County. This raises the question of how to devise a system for developing evidence of the program's effectiveness.

A needle exchange program in Monroe County, aimed at preventing the spread of HIV and hepatitis C, could be evaluated for effectiveness by conducting research to determine if needle exchange programs do reduce the incidence of HIV and hepatitis C.

The following are some suggestions for developing a system for evaluating the effectiveness of the needle exchange program:

Evaluating the effectiveness of the needle exchange program by comparing the incidence of HIV and hepatitis C infections in Monroe County before and after the program's implementation.Designing a control group study in which participants are randomly assigned to receive or not receive services and comparing the infection rates between the two groups.Conducting a qualitative study to collect participants' feedback about their experience with the needle exchange program in Monroe County, including their use of needles before and after the program's implementation.Analyzing the cost-effectiveness of the needle exchange program in Monroe County by comparing the program's costs with the medical costs of treating people with HIV and hepatitis C.

The effectiveness of a needle exchange program can also be evaluated using national data and studies on the effectiveness of similar programs implemented in other cities.

To learn more about hepatitis, visit here

https://brainly.com/question/32729276

#SPJ11

You own an American company selling a product in Russia and the Russian Government passes a law banning all foreign owned companies from advertising in Russia. Using the concepts we have studied what happens to your product and the market for this product? Please add a graph

Answers

If the Russian Government passes a law banning all foreign-owned companies from advertising in Russia, there will be a decrease in the demand for the American company's product and its market.

According to the law, this American company would be unable to advertise its product in Russia, making it difficult to attract customers. If this happens, it would mean that the company’s profit margins would decline significantly due to the reduction in the demand for its products in Russia, which is likely to lead to losses that the company may have to bear.

The graph that represents this would look like:There is a decrease in the demand for American companies products. When foreign-owned companies are banned from advertising in Russia, this would reduce the company's ability to appeal to Russian customers.

The demand for American products would decline significantly.In conclusion, if the Russian government passes a law that bans all foreign-owned companies from advertising in Russia, it would negatively affect the company's product and its market. This would lead to a decrease in the demand for the company's products and lead to losses.

To know more about foreign-owned visit:

brainly.com/question/6890518

#SPJ11

b. Jordan usually pays a price between $14 and $20 per kilogram of sugar. His monthly total expenditure on sugar increases as the price decreases. What does this imply about her price elasticity of demand for sugar? [3 marks]
c. Using the table below calculate the cross price elasticity skirts. Are these goods substitute or complement? Briefly explain. [5 marks]
Price of Sandals Price of Skirts Quantity Demanded of sandals Quantity Demanded of Skirts
5 4 60 100
4 2 80 70

Answers

Jordan's price elasticity of demand for sugar is elastic, as her expenditure on sugar increases with a decrease in price.  Cross-price elasticity is 1.5. Sandals and skirts are substitutes, as a decrease in sandal prices increases skirt demand.

b. The information provided suggests that Jordan's monthly total expenditure on sugar increases as the price decreases. This implies that Jordan's price elasticity of demand for sugar is elastic. In other words, a slight change in the price of sugar leads to a relatively larger change in the quantity demanded.

c. To calculate the cross-price elasticity of skirts, we can use the formula:

Cross Price Elasticity = (Percentage Change in Quantity Demanded of Skirts) / (Percentage Change in Price of Sandals)

First, let's calculate the percentage change in the quantity demanded of skirts:

Percentage Change in Quantity Demanded of Skirts = ((New Quantity Demanded - Initial Quantity Demanded) / Initial Quantity Demanded) * 100

For the initial price of sandals ($5) and the initial quantity demanded of skirts (100):

Percentage Change in Quantity Demanded of Skirts = ((70 - 100) / 100) * 100 = -30%

Now, let's calculate the percentage change in the price of sandals:

Percentage Change in Price of Sandals = ((New Price - Initial Price) / Initial Price) * 100

For the initial price of sandals ($5) and the new price of sandals ($4):

Percentage Change in Price of Sandals = ((4 - 5) / 5) * 100 = -20%

Now, let's calculate the cross-price elasticity:

Cross Price Elasticity = (-30% / -20%) = 1.5

Since the cross-price elasticity is positive and greater than 1, we can conclude that sandals and skirts are substitute goods. This means that as the price of sandals decreases, the quantity demanded of skirts increases, indicating a positive relationship between the two interests.

Learn more about Cross Price Elasticity: https://brainly.com/question/28928812

#SPJ11

Compute the following probabilities If Y is distributed N(8,9),Pr(Y≤6)= (Round your response to four decimal places) If Y is distributed N(−24). Pr (Y>−1)= (Round your response to four decimal places) If Y is distributed N(120,36)Pr(117≤Y≤123)= (Round your response to four decirnal places)

Answers

1. Pr(Y ≤ 6) when Y is distributed N(8, 9):

The probability can be calculated using the standard normal distribution by first standardizing the variable Y.

Standardized variable Z = (Y - μ) / σ,

where μ is the mean and σ is the standard deviation.

For Y ~ N(8, 9):

Z = (6 - 8) / √9 = -2 / 3

Now, we can look up the standardized value in the standard normal distribution table to find the probability.

Pr(Y ≤ 6) = Pr(Z ≤ -2/3)

Looking up the value -2/3 in the standard normal distribution table, we find that Pr(Z ≤ -2/3) is approximately 0.2525.

Therefore, Pr(Y ≤ 6) = 0.2525 (rounded to four decimal places).

2. Pr(Y > -1) when Y is distributed N(-24):

Since we are given a normal distribution with mean μ = -24, we can calculate the standardized variable Z as follows:

Z = (-1 - (-24)) / √variance

  = 23 / √variance

Since the standard deviation is not provided, we cannot directly compute the probability. However, assuming that the variance is equal to 1, we can approximate the probability using the standard normal distribution.

Pr(Y > -1) ≈ 1 - Pr(Z ≤ Z_value)

Using the standard normal distribution table, we find the corresponding value for Z_value = 23 / √1 ≈ 23. This value is not available in the standard normal distribution table, but we can conclude that Pr(Y > -1) is very close to 0.

Therefore, Pr(Y > -1) ≈ 0 (rounded to four decimal places).

3. Pr(117 ≤ Y ≤ 123) when Y is distributed N(120, 36):

We need to find the probability of Y falling within the range [117, 123].

First, we standardize the variables:

Z1 = (117 - 120) / √36 = -3 / 6 = -0.5

Z2 = (123 - 120) / √36 = 3 / 6 = 0.5

Using the standard normal distribution table, we can find the probabilities for the corresponding standardized values:

Pr(Z1 ≤ Z ≤ Z2) = Pr(-0.5 ≤ Z ≤ 0.5)

Looking up the values in the standard normal distribution table, we find Pr(-0.5 ≤ Z ≤ 0.5) ≈ 0.3829.

Therefore, Pr(117 ≤ Y ≤ 123) ≈ 0.3829 (rounded to four decimal places).

In conclusion, the probabilities are:

1. Pr(Y ≤ 6) ≈ 0.2525

2. Pr(Y > -1) ≈ 0

3. Pr(117 ≤ Y ≤ 123) ≈ 0.3829

To know more about distributed, visit;

brainly.com/question/4079902

#SPJ11

explain the elasticity of demand for the products/services sold by this firm?
explain the impact of income elasticity of the demand on this firm?
please use firm-" Enbridge "as a company to describe these two questions?
describe in bullets points as make to presentation on this topic?

Answers

The elasticity of demand is a measure of the responsiveness of demand to changes in price, income, or other variables. Enbridge is a company that provides energy transportation, distribution, and storage services. The following are the explanations for the two questions mentioned: Explain the elasticity of demand for the products/services sold by this firm

The following are some of the factors that influence the elasticity of demand for Enbridge's services: Price: If the cost of Enbridge's services increases, the demand for them decreases, and vice versa. This is because the demand is responsive to price changes. Competition: If there is a high degree of competition in the market, the elasticity of demand for Enbridge's services  is higher than if there is no competition.  Substitutes: The availability of substitutes affects the elasticity of demand for Enbridge's services. For example, if alternative sources of energy are available, the elasticity of demand for Enbridge's services is higher.The impact of income elasticity of demand on this firm:Income elasticity of demand refers to the responsiveness of demand for a good or service to changes in consumer income. If the income elasticity of demand for Enbridge's services is high, it means that the demand for its services is sensitive to changes in income. This implies that if consumer income rises, the demand for Enbridge's services will increase and vice versa. Here are some bullet points to summarize the above discussion:Factors affecting the elasticity of demand for Enbridge's services: Price, competition, substitutes. High competition results in a higher degree of elasticity of demand. Availability of substitutes also results in a higher degree of elasticity of demand. Income elasticity of demand refers to the responsiveness of demand to changes in income. High income elasticity of demand for Enbridge's services implies that demand is sensitive to changes in income.

Learn more https://brainly.com/question/1048608

#SPJ11

he following selected accounts appear in the ledger of Parks Construction inc. at the beginning of the current year: Pref Paic Cor Pai Re During the year, the corporation completed a number of transactions affecting the stockholders' equity, They are summarized as follows: a. Issued 50,000 shares of common stock at $31, recelving cash. b. Issued 13,000 shares of preferred 296 stock at $169. c. Purchased 30,000 shares of treasury common for $27 per share. d. Sold 15,000 shares of treasury common for $30 per share. e. Sold 10,000 shares of treasury common for $25 per share. f. Declared cash dividends of $3.00 per share on preferred stock and $0.06 per share on common stock, g. Paid the cash dividends. Required: Journalize the entries to record the transactions. For a compound transaction, If an amount box does not require an entry, leave it blank. a. 1ssued 50,000 shares of common stock at $31, receiving cash. a. Issued 50,000 shares of common stock at $31, receiving cash. b. Issued 13,000 shares of preferred 2% stock at $169. c. Purchased 30,000 shares of treasury common for $27 per share.. d. Sold 15,000 shares of treasury common for $30 per share. d. Sold 15,000 shares of treasury common for $30 per share. e. Sold 10,000 shares of treasury common for $25 per share. f. Declared cash dividends of $3 per share on preferred stock and $0.06 per share on common stock. 9. Paid the cash dividends.

Answers

Journal entries to record the transactions:

a. Issued 50,000 shares of common stock at $31, receiving cash.

Common Stock 50,000 × $31 = $1,550,000Cash $1,550,000

b. Issued 13,000 shares of preferred 2% stock at $169.

Preferred Stock 13,000 × $169 = $2,197,000Cash $2,197,000

c. Purchased 30,000 shares of treasury common for $27 per share.

Treasury Stock $810,000Cash $810,000d. Sold 15,000 shares of treasury common for $30 per share.

Cash 15,000 × $30 = $450,000

Treasury Stock 15,000 × $27 = $405,000Additional Paid-in Capital $45,000e.

Sold 10,000 shares of treasury common for $25 per share. Cash 10,000 × $25 = $250,000

Treasury Stock 10,000 × $27 = $270,000Paid-in Capital from Treasury Stock Sale ($20,000)f.

Declared cash dividends of $3 per share on preferred stock and $0.06 per share on common stock.

Dividends Payable (Preferred Stock) 13,000 × $3 = $39,000

Dividends Payable (Common Stock) 50,000 × $0.06 = $3,000g.

Paid the cash dividends. Dividends Payable $42,000Cash $42,000 

The total dividends declared and paid:

Preferred Stock: $39,000Common Stock: $3,000Total:

$42,000

Therefore, the required journal entries to record the given transactions are shown above.

To know more about entries visit :

https://brainly.com/question/31824449

#SPJ11

If you want $3.5 million for retirement and you plan to retire in 30 years, how much do you need to deposit today if you can earn 7.25% on your money?

Answers

To calculate the amount you need to deposit today for retirement, we can use the concept of present value (PV) and the formula for calculating it. The formula for present value is:

PV = FV / (1 + r)^n

Where:

PV = Present Value (amount to be deposited today)

FV = Future Value (desired amount for retirement)

r = Interest rate per period (in this case, 7.25% or 0.0725)

n = Number of periods (in this case, 30 years)

Let's plug in the values into the formula:

PV = $3,500,000 / (1 + 0.0725)^30

Calculating this equation will give us the amount you need to deposit today to reach your retirement goal. Let's calculate it:

PV = $3,500,000 / (1.0725)^30

PV = $3,500,000 / 4.919

PV ≈ $711,829.53

Therefore, you would need to deposit approximately $711,829.53 today to accumulate $3.5 million for retirement in 30 years, assuming an interest rate of 7.25% per year.

To know more about deposit, visit,
https://brainly.com/question/1438257

#SPJ11

#1 You are driving down the highway when one of your tires suddenly blows out. You should

Pump your brakes rapidly, and steer your vehicle to control any skids.

Avoid using your brakes. Slow down gradually and concentrate on steering.

Press hard on your brake pedal and stop as quickly as you can.

Answers

Avoid using your brakes. Slow down gradually and concentrate on steering

A duopoly faces a market demand of p=150−Q. Firm 1 has a constant marginal cost of MC 1 =$20. Firm 2 ′ s constant marginal cost is MC 2 =$40. Calculate the output of each firm, market output, and price if there is (a) a collusive equilibrium or (b) a Cournot equilibrium. The collusive equilibrium occurs where q 1 equals and q 2 equals (Enter numeric responses using real numbers rounded to two decimal places) Market output is The collusive equilibrium price is $ The Cournot-Nash equilibrium occurs where q 1 equals and q 2 equals Market output is Furthermore, the Cournot equilibrium price is $
Previous question

Answers

To calculate the output of each firm, market output, and price in a duopoly with a market demand of p=150−Q, Firm 1 having a constant marginal cost of MC1 =$20 and Firm 2 having a constant marginal cost of MC2 =$40, we can analyze both the collusive and Cournot equilibrium.

(a) Collusive equilibrium:
In a collusive equilibrium, firms coordinate their production decisions to maximize joint profits. In this case, q1 and q2 will be equal.
To find the collusive equilibrium output and price, we can start by finding the market output.
Given the market demand equation p=150−Q, we can substitute q1 + q2 for Q:
150 - (q1 + q2) = p
Since q1 = q2 in the collusive equilibrium, we can rewrite the equation as:
150 - 2q = p
Next, we need to determine the individual quantities produced by each firm. Since both firms have the same marginal cost of MC1 =$20 and MC2 =$40, their marginal costs are equal.
To find the output of each firm, we equate the marginal cost to the market price:
MC1 = p
MC1 = 150 - 2q1
20 = 150 - 2q1
2q1 = 130
q1 = 65
Similarly, for Firm 2:
MC2 = p
MC2 = 150 - 2q2
40 = 150 - 2q2
2q2 = 110
q2 = 55
The collusive equilibrium occurs where q1 equals 65 and q2 equals 55.
To find the market output, we sum the individual quantities produced:
Market output = q1 + q2 = 65 + 55 = 120
The collusive equilibrium price can be found by substituting the market output into the demand equation:
p = 150 - Q
p = 150 - 120
p = 30
Therefore, in the collusive equilibrium, the output of each firm is 65 and 55 respectively, the market output is 120, and the collusive equilibrium price is $30.

(b) Cournot-Nash equilibrium:

In a Cournot-Nash equilibrium, firms compete by simultaneously choosing their quantities. Each firm assumes that its rival's output will remain constant.
To find the Cournot equilibrium output and price, we can follow a similar process as before.
First, we determine the individual quantities produced by each firm. Each firm chooses its quantity to maximize its profits, given the quantity chosen by the other firm.
For Firm 1, we find the quantity that maximizes its profit:
MC1 = p
MC1 = 150 - 2q1
20 = 150 - 2q1
2q1 = 130
q1 = 65
For Firm 2, we find the quantity that maximizes its profit, assuming q1 remains constant:
MC2 = p
MC2 = 150 - 2q2
40 = 150 - 2q2
2q2 = 110
q2 = 55
The Cournot-Nash equilibrium occurs where q1 equals 65 and q2 equals 55.
To find the market output, we sum the individual quantities produced:
Market output = q1 + q2 = 65 + 55 = 120
To find the Cournot equilibrium price, we substitute the market output into the demand equation:
p = 150 - Q
p = 150 - 120
p = 30

Therefore, in the Cournot-Nash equilibrium, the output of each firm is 65 and 55 respectively, the market output is 120, and the Cournot equilibrium price is $30.

Learn more about a duopoly at: https://brainly.com/question/33139765

#SPJ11

discuss how a company's Statement of Cash Flows, Income Statement, or Balance Sheet could help them to better understand one of these forces in relation to their desire to expand the company (assume you are a financial analyst within a company that is looking to expand into either a new market or expand within your existing industry and your manager has asked you to assess Porter's Five threats based on the gathering of financial information).

Answers

In the world of business, the forces of Porter's Five are used to determine a company's competitive position in the market and to identify its strengths and weaknesses.


A company's Statement of Cash Flows can help it to better understand the threat of new entrants in the market. By analyzing the company's cash flow over a period of time, a financial analyst can determine if the company has the financial resources necessary to compete with new entrants.
If the company has a strong balance sheet, it may have an advantage over suppliers and buyers because it can negotiate better terms.

However, if the company has a weak balance sheet, it may struggle to negotiate with suppliers and buyers because it may not have the financial resources to do so.
By examining this information, a financial analyst can help the company make informed decisions about expanding into new markets or within its existing industry.

To know more about weaknesses visit:

https://brainly.com/question/15173884

#SPJ11

Solve using financial calculator
Required annuity payments. A father is now planning a savings program to put his daughter through college. She just celebrated her 13th birthday, she plans to enroll at the university in 5 years when she turns 18 years old, and she should graduate in 4 years. Currently, the annual cost (for everything – food, clothing, tuition, books, transportation, and so forth) is $15,000, but these costs are expected to increase by 5% annually. The college requires that this amount be paid at the start of the school year. She now has $7,500 in a college savings account that pays 6% annually. a) How large must each payment be if the father makes five equal annual deposits into her account; the first deposit today and the fifth deposit on the daughter’s 17th birthday? [Hint: Calculate the cost (inflated at 5%) for each year of college and find the PV of these costs, discounted at 6%, as of the day she enters college. Then find the compounded value of her initial $7,500 on that same day. The difference between the PV costs and the amount that would be in the savings account must be made up by the father’s deposits].

Answers

The size of each payment made by the father if he makes five equal annual deposits into her account; the first deposit today and the fifth deposit on the daughter’s 17th birthday is $8,095.21.

The present value of a future payment is referred to as the amount of money required to invest today to provide for that payment in the future. The interest rate used to figure the present value of future cash flows is referred to as the discount rate. The sum of a series of equal payments in a fixed time frame is referred to as an annuity, and the amount of these payments is referred to as the annuity payment. Now, let's solve the question.

We need to calculate the size of each payment made by the father if he makes five equal annual deposits into her account; the first deposit today and the fifth deposit on the daughter’s 17th birthday.
The first step is to compute the total college costs, including the inflation rate, as follows:Year 1 costs = $15,000 * (1 + 5%) = $15,750
Year 2 costs = $15,750 * (1 + 5%) = $16,537.5
Year 3 costs = $16,537.5 * (1 + 5%) = $17,364.38
Year 4 costs = $17,364.38 * (1 + 5%) = $18,232.60


The present value of all these four payments, discounted at 6% from the time the daughter enters college, is computed as follows:
PV of year 4 cost = $18,232.60 / (1 + 6%)^4 = $13,167.54
PV of year 3 cost = $17,364.38 / (1 + 6%)^3 = $12,049.23
PV of year 2 cost = $16,537.50 / (1 + 6%)^2 = $10,707.25
PV of year 1 cost = $15,750 / (1 + 6%)^1 = $8,537.74


The total PV of the college costs is: $13,167.54 + $12,049.23 + $10,707.25 + $8,537.74 = $44,462.76.
The compounded value of the amount already in the savings account will be: $7,500 * (1 + 6%)^5 = $10,551.08.
The amount that must be covered by the father's deposits is $44,462.76 - $10,551.08 = $33,911.68.
To get this sum in five equal annual payments, we must compute the size of each payment using the annuity formula:
Payment = PV x (r / (1 - (1 + r)^-n))
PV = $33,911.68
r = 6%
n = 5
Payment = $33,911.68 x (6% / (1 - (1 + 6%)^-5)) = $8,095.21 (rounded to the nearest cent).


Therefore, the size of each payment made by the father if he makes five equal annual deposits into her account; the first deposit today and the fifth deposit on the daughter’s 17th birthday is $8,095.21.

To learn more about payment, here:

https://brainly.com/question/32320091

#SPJ11

Required information E3-7 (Algo) Recording Journal Entries LO3-4 [The following information applies to the questions displayed below.] Vail Resorts, Incorporated, owns and operates over 30 premier ski resort properties (located in the Colorado Rocky Mountains, the Lake Tahoe area, the upper midwest, the northeast, mid-Atlantic states, and Australia). The company also owns a collection of luxury hotels, resorts, and lodging properties. The company sells lift tickets, ski and snowboard lessons, and ski equipment. The following hypothetical December transactions are typical of those that occur at the resorts. a. Borrowed $3,600,000 from the bank on December 1 , signing a note payable due in six months. b. Purchased a new snowplow for $78,000 cash on December 31 . c. Purchased ski equipment inventory for $44,000 on account to sell in the ski shops. d. Incurred $64,000 in routine repairs expense for the chairlifts; paid cash. e. Sold $381,000 of January through March season passes and recelved cash. f. Sold a pair of skis from inventory in a ski shop to a customer for $490 on account. g. The cost of the skis sold in (f) was $250. h. Sold dally lift passes in December for a total of $261,000 in cash. i. Received a $3,400 deposit on a townhouse to be rented for five days in January. 1. Paid half the charges incurred on account in (c). k. Received $480 on account from the customer in ( $. 1. Paid $261,000 in wages to employees for the month of December. 2. Assume that Vail Resorts had a $1,340 balance in Accounts Receivable at the beginning of December. Determine the ending balance in the Accounts Receivable account at the end of December based on transactions (a) through (h.

Answers

A. Borrowed $3,600,000 from the bank on December 1, signing a note payable due in six months. (Assets increase by $3,600,000;

liabilities increase by $3,600,000)DR Cash $3,600,000CR Notes Payable $3,600,000B. Purchased a new snowplow for $78,000 cash on December 31. (Assets decrease by $78,000)DR Equipment $78,000CR Cash $78,000C.

Purchased ski equipment inventory for $44,000 on account to sell in the ski shops. (Assets increase by $44,000)DR Ski Equipment Inventory $44,000CR Accounts Payable $44,000

1. Paid half the charges incurred on account in (c). (Liabilities decrease by $22,000)DR Accounts Payable $22,000CR Cash $22,000

2. Received $480 on account from the customer in (f). (Assets increase by $480)DR Accounts Receivable $480CR Sales Revenue $480D. Incurred $64,000 in routine repairs expense for the chairlifts;

paid cash. (Assets decrease by $64,000)DR Repairs Expense $64,000CR Cash $64,000E. Sold $381,000 of January through March season passes and received cash. (Assets increase by $381,000)

DR Cash $381,000CR Unearned Revenue $381,000F. Sold a pair of skis from inventory in a ski shop to a customer for $490 on account. (Assets increase by $490)

DR Accounts Receivable $490CR Sales Revenue $490G. The cost of the skis sold in (f) was $250. (Assets decrease by $250)DR Cost of Goods Sold $250CR Inventory $250H. Sold daily lift passes in December for a total of $261,000 in cash. (Assets increase by $261,000)DR Cash $261,000CR

Sales Revenue $261,0001. Paid $261,000 in wages to employees for the month of December. (Assets decrease by $261,000)DR Wages Expense $261,000CR Cash $261,0002. Assume that Vail Resorts had a $1,340 balance in

From transaction (2), $480 has been subtracted from the account, making the balance $1,350 ($1,830 − $480).Hence, the ending balance in the Accounts Receivable account at the end of December based on transactions (a) through (h) is $1,350.

To know more about increase visit :

https://brainly.com/question/16029306

#SPJ11

Gilead Science stock sells for $17 per share and you have decided to purchase as many shares as you possibly can. You have $31,000 available to invest. What is the maximum number of shares you can buy if the initial margin is 60% ? (5 marks) 6. You decide to buy 1,200 shares of stock at a price of $34 and an initial margin of 55 percent. What is the maximum percentage decline in the stock before you will receive a margin call if the maintenance margin is 35 percent?

Answers

The maximum percentage decline in the stock before you receive a margin call is approximately -35%.

To determine the maximum number of shares you can buy with a given investment amount and initial margin, we need to calculate the maximum amount you can invest (account value) based on the initial margin and then divide it by the stock price.

Maximum number of shares you can buy:

Account Value = Available Investment / Initial Margin

Account Value = $31,000 / 0.60

Account Value = $51,666.67

Number of Shares = Account Value / Stock Price

Number of Shares = $51,666.67 / $17

Number of Shares ≈ 3,039 shares (rounded down to the nearest whole number)

Therefore, the maximum number of shares you can buy is approximately 3,039 shares.

To calculate the maximum percentage decline in the stock before you receive a margin call, we need to consider the maintenance margin. The maintenance margin represents the minimum account value required as a percentage of the total value of the securities held.

Account Value = Number of Shares * Stock Price

Account Value = 1,200 * $34

Account Value = $40,800

Margin Call Threshold = Account Value * (1 - Maintenance Margin)

Margin Call Threshold = $40,800 * (1 - 0.35)

Margin Call Threshold = $26,520

Maximum Percentage Decline = (Margin Call Threshold - Account Value) / Account Value

Maximum Percentage Decline = ($26,520 - $40,800) / $40,800

Maximum Percentage Decline ≈ -0.35 (or -35%)

Therefore, the maximum percentage decline in the stock before you receive a margin call is approximately -35%.

To know more about stock   here

https://brainly.com/question/26128641

#SPJ11

Since the start of Malaysia's statewide lockdown, manufacturers and employers have struggled with lesser outputs

Answers

Malaysia’s lockdown was implemented to stop the spread of COVID-19. Manufacturers and employers were adversely affected by the statewide lockdown. Employers and manufacturers were struggling with lesser outputs. It was an unprecedented time that the world had never experienced before.

The lockdown meant that many businesses had to close. The employers were forced to shut down their businesses to stop the spread of the virus. The economic impact of the pandemic has been felt worldwide. Many people lost their jobs, and companies had to shut down because they could not sustain their businesses due to the lockdown.

The lockdown measures put in place were necessary to contain the spread of COVID-19. However, it had a significant impact on businesses and their output. Manufacturers had to reduce their production, and employees had to work from home. This led to decreased efficiency and output. To mitigate the effects of the lockdown, the government implemented economic stimulus packages to support businesses and industries. Although there is hope for recovery, the effects of the pandemic will be felt for years to come.

To know more about COVID-19 visit:

https://brainly.com/question/30975256

#SPJ11

Sandra Robinson deposited $2.700 today in an account paying 6 percent interest annually. (Round intermediate calculations to 8 de places, e.8. 2.51251245.) What would be the simple interest earned on this investment in 5 years? (Round final answer to 0 decimal place, eg. 150.) Simple interest on investment

Answers

Tthe simple interest earned on this investment in 5 years would be $810.

To calculate the simple interest earned on the investment, we can use the formula:

Simple Interest = Principal (P) * Interest Rate (R) * Time (T)

Given:

Principal (P) = $2,700

Interest Rate (R) = 6% = 0.06 (decimal form)

Time (T) = 5 years

Substituting the values into the formula, we have:

Simple Interest = $2,700 * 0.06 * 5 = $810

Learn more about simple interest

https://brainly.com/question/30964674

#SPJ11

com Process Cost Journal Entries In October, the cost of materials transferred into the Rolling Department from the Casting Department of Kraus Sted Company is $543,700. The conversion cest for the end the Rolling Department is $114,500 (566,100 factory overhead applied and 148,400 direct labor). The total cost transferred to Finished Goods for the penod was 8000 The Department had a beginning inventory of $20,000. al. Journalize the cost of transferred-in materials. If an amount box does not require an entry, leave it blank a2. Journalize the conversion costs. If an amount box does not require an entry, leave it blank. 88 D a3. Journalize the costs transferred out to Finished Goods. If an amount box does not require an entry, leave it blank b. Determine the balance of Work in Process-Rolling at the end of the period. Next Previous

Answers

The cost of transferred-in materials would be recorded as a debit to the Work-in-Process Rolling account and a credit to the Materials Control account. The entry is:

Work-in-Process Rolling     543,700
Materials Control                543,700

Conversion costs would be recorded as a debit to the Work-in-Process Rolling account and a credit to the relevant accounts that have incurred the costs. The entry is:

Work-in-Process Rolling      566,100
Direct Labor                             148,400
Factory Overhead Control      417,700

Cost transferred out to finished goods would be recorded as a debit to Finished Goods Inventory and a credit to the Work-in-Process Rolling account. The entry is:

Finished Goods Inventory           800,000
Work-in-Process Rolling           800,000

To know more about credit visit:

https://brainly.com/question/24272208

#SPJ11

Rosie Dry Cleaning was started on January 1 , Year 1 . It experienced the following events during its first two years of operation: Events Affecting Year 1 1. Provided $29,220 of cleaning services on account. 2. Collected $23,376 cash from accounts receivable. 3. Adjusted the accounting records to reflect the estimate that uncollectible accounts expense would be 1 percent of the cleaning revenue on account. Events Affecting Year 2 1. Wrote off a $219 account receivable that was determined to be uncollectible. 2. Provided $34,100 of cleaning services on account. 3. Collected $30,179 cash from accounts receivable. 4. Adjusted the accounting records to reflect the estimate that uncollectible accounts expense would be 1 percent of the cleaning revenue on account. Required a. Organize the transaction data in accounts under an accounting equation for each year. b. Determine the following amounts: 1. (1) Net income for Year 1. 2. (2) Net cash flow from operating activities for Year 1. 3. (3) Balance of accounts receivable at the end of Year 1. 4. (4) Net realizable value of accounts receivable at the end of Year 1. c. Determine the following amounts: 1. (1) Net income for Year 2.

Answers

a. Accounting Equation for Year 1:

Assets = Liabilities + Owner's Equity

Accounts Receivable + Cash = 0 + Owner's Equity (Cleaning Revenue)

Transaction Data for Year 1:

1. Accounts Receivable increases by $29,220.

2. Cash increases by $23,376.

3. Estimated Uncollectible Accounts Expense increases by 1% of Cleaning Revenue on account.

Revised Accounting Equation for Year 1:

Accounts Receivable + Cash = Estimated Uncollectible Accounts Expense + Owner's Equity (Cleaning Revenue)

Accounting Equation for Year 2:

Assets = Liabilities + Owner's Equity

Accounts Receivable + Cash = 0 + Owner's Equity (Cleaning Revenue)

Transaction Data for Year 2:

1. Accounts Receivable decreases by $219 (uncollectible account).

2. Accounts Receivable increases by $34,100.

3. Cash increases by $30,179.

4. Estimated Uncollectible Accounts Expense increases by 1% of Cleaning Revenue on account.

Revised Accounting Equation for Year 2:

Accounts Receivable + Cash = Estimated Uncollectible Accounts Expense + Owner's Equity (Cleaning Revenue)

b. Amounts for Year 1:

1. Net income for Year 1: Cleaning Revenue - Estimated Uncollectible Accounts Expense

2. Net cash flow from operating activities for Year 1: Cash collected from accounts receivable

3. Balance of accounts receivable at the end of Year 1: Accounts Receivable - Cash collected

4. Net realizable value of accounts receivable at the end of Year 1: Balance of accounts receivable - Estimated Uncollectible Accounts Expense

c. Amounts for Year 2:

1. Net income for Year 2: Cleaning Revenue - Estimated Uncollectible Accounts Expense

(Note: You will need the specific cleaning revenue and estimated uncollectible accounts expense amounts for Year 2 to calculate the net income.)

Please provide the cleaning revenue and estimated uncollectible accounts expense amounts for Year 2 to calculate the net income for Year 2.

To know more about expense, visit,
https://brainly.com/question/14697297

#SPJ11

Old Navy's Talent Strategy Fills Some Gaps Retailing is a difficult business, involving stiff competition both online and off,

Answers

Old Navy is a retail company that sells clothing, accessories, and personal care items. It is one of the subsidiaries of Gap Inc. In recent years, Old Navy has had to compete with various retail stores both online and offline. Old Navy has been successful because of its talent management strategy, which has helped it fill gaps in the retailing business.Old Navy's talent strategy has played a significant role in the company's success.

Old Navy's talent management strategy focuses on hiring and retaining the best employees to fill gaps in the company's workforce. The company seeks employees with the right skills, experience, and talent to fill open positions. This strategy ensures that the company has the right people to achieve its goals and objectives.Old Navy's talent strategy includes various practices to fill gaps in the retailing business. One of these practices is hiring from diverse backgrounds.

The company has a culture of diversity, equity, and inclusion, which ensures that it attracts talent from various backgrounds. This strategy has helped the company develop innovative ideas that have contributed to its success. Another practice is providing employees with development opportunities. The company invests in its employees' development, providing them with training and development programs.

This practice ensures that employees have the necessary skills and knowledge to perform their jobs effectively.In conclusion, Old Navy's talent strategy has played a significant role in the company's success. The company's focus on hiring and retaining the best employees has helped it fill gaps in the retailing business. Old Navy's talent management strategy includes various practices, such as hiring from diverse backgrounds and providing development opportunities to employees. These practices have contributed to the company's success.

To know more about accessories visit:

https://brainly.com/question/23210394

#SPJ11

Copy\%20of Multiples Which of the following statements is (are) TRUE? Select one or more alternatives: The EV/Sales multiple may be more appropriate for valuing companies that are making a loss than the PE multiple. We should not expect to find significant differences in PE ratios for firms operating in the same industry. A possible disadvantage of using multiples to value a company is that it may be difficult to find enough comparable companies. For a company with positive earnings growth, we would expect the forward-looking PE multiple to be higher than the current PE multiple.

Answers

For companies with positive earnings growth, we expect the forward-looking PE multiple to be higher than the current PE multiple. This is due to the expectation that earnings will increase in the future.

Since the forward-looking PE ratio estimates future earnings, it should reflect the company's earnings growth potential.

The following statement is true:

For a company with positive earnings growth, we would expect the forward-looking PE multiple to be higher than the current PE multiple.

A possible disadvantage of using multiples to value a company is:

It may be difficult to find enough comparable companies. Using multiples to value a company requires finding comparable firms in the same sector with similar characteristics such as the business model, market conditions, and financial ratios. If there are no comparable firms, it becomes challenging to make informed judgments about the value of the company based on multiples.

EV/Sales multiples can be an alternative to PE multiples when evaluating companies with negative earnings. This is because:

EV/Sales multiples utilize the company's sales rather than profits, which is better suited to companies with no earnings or negative earnings.

However, it is important to note that companies operating in the same industry and market conditions will have different PE ratios. Therefore, expecting identical PE ratios for companies in the same industry is unrealistic. Investors use PE ratios as a preliminary screening tool to identify companies with the best potential to provide high returns.

For companies with positive earnings growth, we expect the forward-looking PE multiple to be higher than the current PE multiple. This is due to the expectation that earnings will increase in the future. Since the forward-looking PE ratio estimates future earnings, it should reflect the company's earnings growth potential.

Learn more about earnings growth

https://brainly.com/question/13738209

#SPJ11

write a report on the market segmentation of the McDonalds. (1000 words )

Answers

Market segmentation is a strategy that helps a company divide its customers into smaller groups based on their needs, preferences, behaviors, and characteristics. The main purpose of market segmentation is to understand the diverse needs of customers.

Geographic Segmentation:
Geographic segmentation is a method of dividing the market based on geographic factors such as region, climate, population density, etc. McDonald’s operates in more than 100 countries, and it adapts its menu and marketing strategies according to the local needs and preferences of its customers. For example, McDonald’s serves rice-based meals in Asian countries, while it serves meat-based meals in Western countries.

Demographic Segmentation:
Demographic segmentation is a method of dividing the market based on demographic factors such as age, gender, income, education, etc. McDonald’s caters to a diverse customer base, and it offers different products and services to different age groups and genders.

Psychographic Segmentation:
Psychographic segmentation is a method of dividing the market based on psychographic factors such as personality, lifestyle, values, beliefs, etc. McDonald’s targets customers who value convenience, affordability, and speed. McDonald’s offers quick service, drive-thru service, and home delivery service to its customers.

Behavioral Segmentation:
Behavioral segmentation is a method of dividing the market based on behavioral factors such as usage, loyalty, benefits, occasions, etc. McDonald’s offers different products and services to different types of customers based on their behavior.
Conclusion:
McDonald’s has successfully implemented market segmentation strategies to cater to the diverse needs and preferences of its customers. By using geographic, demographic, psychographic, and behavioral segmentation methods, McDonald’s has been able to offer customized products and services to its customers in different countries. This has helped McDonald’s to establish itself as one of the leading fast-food chains in the world.

To know more about characteristics visit :

https://brainly.com/question/31108192

#SPJ11

Use the database shown in Figures 4&5 to answer Problems 13−16. ROBCOR is an aircraft charter company that supplies on-demand charter flight services using a fleet of four aircraft. Aircrafts are identified by a unique registration number. Therefore, the aircraft registration number is an appropriate primary key for the AIRCRAFT table. The destinations are indicated by standard three-letter airport codes. For example, STL=St. Louis, MO ATL= Atlanta, GA BNA = Nashville, TN Table name: AIRCRAFT \( \begin{array}{ll}\text { AC_TTAF } & =\text { Aircraft total time, airframe (hours) } \\ \text { AC_TTEL } & =\text { Total time, left engine (hours) } \\ \text { AC_TTER } & =\text { Total time, right engine (hours) }\end{array} \) In a fully developed database system, such attribute values would be updated by application software when the CHARTER table entries are posted. Table name: MODEL Customers are charged per roundtrip mile, using the MOD_CHG_MILE rate. The MOD_SEATS gives the total number of seats in the airplane, including the pilot and copilot seats. Therefore, a PA31-350 trip that is flown by a pilot and a copilot has eight passenger seats available. Database name: Ch03_AviaCo The pilot licenses shown in the PILOT table include the ATP = Airline Transport Pilot and COM = Commercial Pilot. Businesses that operate "on demand" air services are governed by Part 135 of the Federal Air Regulations (FARs) that are enforced by the Federal Aviation Administration (FAA). Such businesses are known as "Part 135 operators." Part 135 operations require that pilots successfully complete flight proficiency checks each six months. The "Part 135" flight proficiency check date is recorded in PIL_PT135_DATE. To fly commercially, pilots must have at least a commercial license and a 2 nd class medical certificate (PIL_MED_TYPE = 2.) The PIL_RATINGS include SEL SES CFI ​
= Single Engine, Land = Single Engine (Sea) = Certified Flight Instructor ​
MEL = Multi-engine Land Instr. = Instrument CFII = Certified Flight Instructor, Instrument ​
The nulls in the CHARTER table's CHAR_COPILOT column indicate that a copilot is not required for some charter trips or for some aircraft. Federal Aviation Administration (FAA) rules require a copilot on jet aircraft and on aircraft having a gross take-off weight over 12,500 pounds. None of the aircraft in the AIRCRAFT table are governed by this requirement; however, some customers may require the presence of a copilot for insurance reasons. All charter trips are recorded in the CHARTER table. 13. For each table, identify the primary key and foreign key(s) when possible. You want to see data on charters flown by either Robert Williams (employee numberl05) or Elizabeth Travis (employee number 109) as pilot or copilot, but not charters flown by both of them. Complete Problems 14-16 to find this information. 14. Create the table that would result from applying the SELECT and PROJECT relational operators to the CHARTER table to return only the CHAR_TRIP, CHAR_PILOT, and CHAR_COPILOT attributes for charters flown by either employee 105 or employee 109 as pilot or copilot. 15. Create the table that would result from applying the SELECT and PROJECT relational operators to the CHARTER table to return only the CHAR_TRIP,CHAR_PILOT, and CHAR_COPILOT attributes for charters flown by both employee 105 and employee 109. 16. Create the table that would result from applying a DIFFERENCE relational operator of your result from Problem 14 to your result from Problem

Answers

14. Create the table that would result from applying the SELECT and PROJECT relational operators to the CHARTER table to return only the CHAR_TRIP, CHAR_PILOT, and CHAR_COPILOT attributes for charters flown by either employee 105 or employee 109 as pilot or copilot.

```sql

SELECT CHAR_TRIP, CHAR_PILOT, CHAR_COPILOT

FROM CHARTER

WHERE (CHAR_PILOT = 105 OR CHAR_COPILOT = 105)

AND (CHAR_PILOT = 109 OR CHAR_COPILOT = 109);

```

15. Create the table that would result from applying the SELECT and PROJECT relational operators to the CHARTER table to return only the CHAR_TRIP, CHAR_PILOT, and CHAR_COPILOT attributes for charters flown by both employee 105 and employee 109.

```sql

SELECT CHAR_TRIP, CHAR_PILOT, CHAR_COPILOT

FROM CHARTER

WHERE CHAR_PILOT IN (105, 109)

AND CHAR_COPILOT IN (105, 109)

AND CHAR_PILOT != CHAR_COPILOT;

```

16. Create the table that would result from applying a DIFFERENCE relational operator of your result from Problem 14 to your result from Problem 15.

```sql

SELECT CHAR_TRIP, CHAR_PILOT, CHAR_COPILOT

FROM (

 SELECT CHAR_TRIP, CHAR_PILOT, CHAR_COPILOT

 FROM CHARTER

 WHERE (CHAR_PILOT = 105 OR CHAR_COPILOT = 105)

 AND (CHAR_PILOT = 109 OR CHAR_COPILOT = 109)

) AS A

EXCEPT

SELECT CHAR_TRIP, CHAR_PILOT, CHAR_COPILOT

FROM (

 SELECT CHAR_TRIP, CHAR_PILOT, CHAR_COPILOT

 FROM CHARTER

 WHERE CHAR_PILOT IN (105, 109)

 AND CHAR_COPILOT IN (105, 109)

 AND CHAR_PILOT != CHAR_COPILOT

) AS B;

```

Learn more about relational operators  from :

https://brainly.com/question/28039937

#SPJ11

According to "game theory," if lying is unethical, then "bluffing" is also unethical True False Different societies may have different ethics, but the morals of any given individual should remain relatively constant no matter which society that person should happen to be in at any point in time True False (1 point) Federal law now requires that businesses adopt a code of ethics True False ∼ Saved Two broad categories of ethical theories exist, based on either consequential principles or on nonconsequential principles True False

Answers

Game theory is a mathematical study of decision-making processes involved in interactions between two or more rational individuals.

It is widely used to make predictions about social interactions between individuals, businesses, and even governments.According to game theory, bluffing can be ethical even if lying is unethical. For example, bluffing in a game of poker is considered ethical.

The reason behind this is that both players know that bluffing is allowed, and they agree to follow the rules. In this scenario, both parties can use bluffing tactics to deceive each other. Therefore, bluffing is ethical because both players are following the rules of the game.

Whereas lying is unethical because it involves making false statements, and the other person is unaware of it.Different societies have different ethics, but the morals of any given individual should remain relatively constant no matter which society that person happens to be in at any point in time.

This statement is false because an individual's morals and ethical values can change based on their experiences and environment. These values are influenced by the culture and social norms of the society they belong to. For example, smoking marijuana may be considered unethical in some societies, whereas it may be legal and acceptable in others.

To know more about decision-making visit:

https://brainly.com/question/30697303

#SPJ11

Supply Chain Management Careers
The purpose of this assignment is to learn more about "Supply Chain Management and potential careers in the Supply Chain Management by researching career descriptions and different elements of a career in SCM.
. The presentation must include:
Introduction slide
4-5 content slides, each with 3-5 key points
Please include as a minimum:
Introduction
Reason why you are considering a role in Supply Chain Management
Type of position that seems most appealing to you and why (Buyer / Expeditor / Inventory Management / Logistics / Other)
Describe the job responsibilities and/or requirements of the position that seem most appealing to you.
Identify and explain 2 job responsibilities of the position that you would not find very interesting
Conclusion

Answers

Supply Chain Management (SCM) is the management of the entire supply chain, from raw material procurement to final product delivery, ensuring that all processes are streamlined and cost-effective. This discipline is concerned with ensuring that products are delivered on time, that quality is maintained, and that prices are kept low.

A supply chain is made up of many different types of jobs, each of which requires a unique set of skills, knowledge, and experience. The following are some of the most common positions in SCM.· Buyer: This role is responsible for purchasing raw materials, equipment, and other supplies for a company.·

Expeditor: This role is responsible for ensuring that the delivery of goods and materials is on schedule and that all paperwork and documentation are in order.· Inventory Management: This role is responsible for managing a company's inventory levels to ensure that they are optimized for production and sales.·

Logistics: This role is responsible for coordinating the movement of goods and materials, including shipping, transportation, and warehousing.· Other: There are many other positions in SCM, including supply chain analysts, supply chain consultants, and supply chain managers. The type of position that seems most appealing to me is the role of an Inventory Manager. The reason why I am considering a role in Supply Chain Management is because I enjoy working with people, and I enjoy solving problems. An Inventory Manager is responsible for managing a company's inventory levels to ensure that they are optimized for production and sales.

To know more about management visit:

https://brainly.com/question/32216947

#SPJ11

From the list of the items in inventory, what is the sum of the items classified as B & C using ABC Classification System? Item # Total Value in Peso 1 5,000 10 100 200 30 2 3 4 5 O 300 O 5,200 O 5,340 O 340 O 40

Answers

The sum of items classified as B and C using the ABC Classification System is 17,880 pesos.

To determine the sum of items classified as B and C using the ABC Classification System, we need to identify which items fall into these categories based on their total value in pesos.

From the given inventory list, the items classified as B and C are:

Item #1: Total Value = 5,000 pesos (Category B)

Item #2: Total Value = 3,000 pesos (Category C)

Item #3: Total Value = 4,200 pesos (Category C)

Item #4: Total Value = 5,340 pesos (Category B)

Item #5: Total Value = 340 pesos (Category C)

To calculate the sum, we add the total values of these items together:

5,000 + 3,000 + 4,200 + 5,340 + 340 = 17,880 pesos

Therefore, the sum of items classified as B and C using the ABC Classification System is 17,880 pesos.

To learn more about Classification System

https://brainly.com/question/645379

#SPJ11

Sharp’s Sandwich Shop—Inventory Management
Dawn Sharp is the owner of Sharp’s Sandwich Shop. Her shop is open 24/7 and serves many different types of sandwiches, from classic breakfast sandwiches to more exotic burgers and other sandwiches usually consumed at lunch and dinner. Not all of the menu items are available all day. Dawn has divided her menu into four timeframes—breakfast, lunch, dinner, and after hours. Breakfast runs from 5 a.m. to 11 a.m. Lunch begins at 11 a.m. and ends at 3 p.m. Dinner begins early, at 3 p.m., and continues until 9 p.m. Between 9 p.m. and 5 a.m., customers can select sandwiches from the after-hour’s section of the menu.
Sharp’s Sandwich Shop is in the heart of downtown New York City. Some periods are more brisk than others; however overall, because it is the city that never sleeps, business is reasonably steady most days. New Yorkers are fast moving and always in a rush. Consequently, no one wants to wait very long for their sandwich, no matter how unique or complicated it may be. Because of this, Dawn has set up a system where the kitchen produces specific sandwiches in bulk. For example, a basic ham and cheese on rye bread can be made in advance, wrapped, and placed in the ready bin. This way, when a customer orders a ham and cheese on rye, they get it quickly.
One challenge to this system is warm sandwiches. Depending on the complexity, that is, is it a plain cheese burger, or one with specific toppings selected by the customer, a premade warm sandwich can be made and placed in the warmer.
Another challenge to this system is that Sharp’s sandwiches are very popular because of the quality of the sandwiches. Part of the quality is their freshness. Therefore, whether it is a cold sandwich or a warm sandwich, neither can stay in the premade bins too long. After a set period of time, if a sandwich is still in the bin it is removed and placed in the charity bin. The charity bin contains food that is still edible; however, won’t be sold to Sharp’s customers. The food in the charity bin is donated to a local homeless shelter twice a day.
Dawn strongly believes in giving back to the community. Her company sponsors runs for several causes throughout the year. Therefore, although it would be easier to throw out the food whose freshness life has reached its limit according to her standard of quality, giving it to the homeless shelter is an important outreach program for her. However, obviously, Dawn’s business model is based on selling the food, not giving it away. She realizes she cannot completely prevent items from sitting in the bins past her standard-of-freshness quality time. However, as she reviews her monthly financial statements, Dawn sees a trend of increasing waste, that is, more going into the charity bin.
As Dawn examines her financials, she notices that her sandwich shop is going through certain inventory items faster than usual. From the ingredients listed, Dawn suspects that more of the high-end sandwiches are reaching her freshness quality time limit. Furthermore, as she compares the point-of-sale data to her inventory expense data, she concludes that there are spikes in the day where more sandwiches are reaching the charity bin.
Dawn speculates on what could be the issue. She reflects back on her class in supply chain management, specifically the inventory management chapter. She realizes that her primary focus had been on freshness, a key quality metric. She also recognized that timely service was another key quality metric that enabled her to get high customer satisfaction ratings. In hindsight, Dawn grasps that she had ignored basic inventory requirements while focusing on quality. Because of the freshness issue, more and more, her staff was making two sandwiches and only charging for one. Dawn firmly believes she cannot compromise on the quality; however, she needs to improve her inventory management in order to eliminate the growing waste.
1. Considering Sharp’s Sandwich Shop’s inventory issue, justify to Dawn what type of inventory review system she should establish. Go one step further, explain how this supports your previous answers to the above questions.

Answers

The type of inventory review system that Dawn should establish is the Just-In-Time (JIT) inventory system. The JIT system is an inventory strategy that enables businesses to minimize their inventory and minimize waste while ensuring that they have the necessary supplies on hand to complete their operations.

Instead of purchasing a large number of supplies, companies that utilize the Just-In-Time system purchase just enough inventory to meet current needs and deliver the materials right before they are needed.JIT is a cost-effective inventory management system that minimizes inventory holding expenses and eliminates inventory waste. By establishing a JIT inventory system, Dawn can improve her inventory management and reduce waste. With this system, her employees will order supplies when they need them, and only what they need, which will eliminate over-ordering, excess stockpiling, and waste. It will also help to reduce the risk of overstocking and running out of important materials, enabling her to manage her inventory more effectively, freeing up space, and lowering her costs.

She will only buy and hold as much stock as needed and thus not hold excess inventory, which will save her on storage costs. In addition, the JIT system will help in improving the quality of service to customers. Since the quality of sandwiches is of paramount importance to Dawn, JIT ensures that the ingredients are fresh when required. Thus, the JIT inventory system complements her focus on quality by enabling her to maintain the freshness of her sandwiches while ensuring that the inventory is managed more effectively.

To learn more about Just-In-Time,visit here

https://brainly.com/question/32267042

#SPJ11

Other Questions
Derwent Dam can be approximated as barrier with a vertical face that is 33.39 m in height and has a crest length of 307 m. If the reservoir depth is reported at 35.99 m, what is the likely overflow discharge (in m^3/s) Distributive justice is about the question how the benefits and burdens are divided among groups of people. Statement 2: Procedural justice is about the question who is involved in the decision-making process Only Statement 1 is correct Only statement 2 is correct Both statements are correct Both statements are incorrect If the rank of an 85 matrix A is 4 and the rank of a 58 matrix B is 2, what is the maximum rank of the 88 matrix AB?Pick ONE option a)5b)2c)8d)4 The special method that is used to create a string representation of a Python object is the a. to string() b. str() c. toString()d. str_0 An object that has been created and is running in memory is called: a. a running object b. a instance of the object c. a template object d. a class method: Charles Hamilton Houston and Thurgood Marshall began an NAACP campaign to attack the concept of separate but equal in the 1930s.Group of answer choicesTrueFalse In a circuit we want to connect a 25 source to a load of 150 with a transmission line of 50 . To achieve maximum power transfer, an inductor will be connected in series with the source. Determine the value of the inductor reactance. [Note: In this case the resistance of the source is not the same value as the impedance of the line, so what will be the endpoint in the Smith Chart?] Graph the functions on the same coordinate plane. Supporters of the Dawes Act of 1887 said the law would:__.a. help Indigenous peoples become landowners and farmers. b. help Indigenous peoples by freeing them from reservations. c. harm Indigenous peoples by offering them unproductive land. d. harm Indigenous peoples by giving their land to homesteaders. Poll results taken from groups in which there is greater diversity of opinion are also more likely to have:a. a larger margin of error.b. less attrition.c. more than one mode.d. none of the above. CASEDuring the last two decades, the service-oriented industry has seen tremendous growth. Service has registered tremendous growth. Service has become an integral part of modern business. Even companies that deal in tangible products like manufacturing firms now pay attention to aspects of service in their product offering. The focus on quality is due to the intensive competition faced by businesses these days. In the financial services sector, firms offer very similar products and services only distinguishable by brand names. One of the ways in which the financial services firms can distinguish themselves is through the quality of service that they offer. This has a direct impact on their profitability. The quality of service is directly connected with profits, customer expectations and performance of the firm. For the financial services firms, the quality of service offered to customers is key, because of the ability of customers to easily switch to competitors. The service quality model (SERVQUAL) developed by Parasuraman et al (1985) is one of the most famous tools for measuring service quality. Required: Using a standard report format (i.e. Abstract, table of contents, Introduction, main body, summary/conclusion):Discuss in what ways good service quality can be a source of competitive advantage for a bank. Identify the components of the SERVQUAL model and show how it can be applied by the bank to improve the service quality.1. Use Times New Roman as font, and 12 as font size.2. Use 1.5 line spacing.3. Justify the paragraphs, i.e. blocked left and right.4. Word count: minimum 1,000 words and maximum 1,500 words.5. Acknowledge/reference the source of material (i.e. inside text referencing) using APA system of referencing. Failure to do so amounts to plagiarism. 6. The assignment should have a table of contents, introduction, main body, conclusion and references.7. State your student number only.8. Submit in PDF format.9. Strictly observe submission deadline, as late submissions shall not be graded.Notes: 1. Submissions via e-mail will not be graded.2. Submissions with SI above 30 will not attract any marks.3. Ten marks will be awarded for grammar, spelling, format etc of the report. Discuss the different crowding and privacy design directions youwould take with a client with an internal locus of controlversus a client with an external locus of control. Question: Discuss ways to reduce stress and factors that promotehealth, quality life and happiness.Answer should based on Textbooks, internet data is not reliable.So, use only textbook to answer it Question 29 What is the most likely state of process P5? (solid lines: resources are held by process, deah lines: the processes are waiting for the resources) Main Memory 1/0 10 10 P4 O ready O blocked/suspendO blockedO suspend Question 23 For a single-processor system_______(choose the best answer) a. processes spend long times waiting to execute b. there will never be more than one running process c. process scheduling is always optimal d. context switching between processes is unusual Question 24 Which of the following state transitions is not possible? O running to blocked O blocked to ready O blocked to running O ready to running Is the crRNA match theDNA in the coding region or the promoter region?HDR-NS ODN CGCCGGCG CTGGACGTCCGTACGTTCGAACCGTGACCGGCAGCAAAATGTTGCAGCACTGACCCTTTTGG 5' GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACT Project management1.1 Learning Outcomes:Understanding and recognition of ProjectsImportance of ProjectsIdentifying the nature of Project6.2 Action Required:Read the following Statement:"Some projects are described as White Elephants"6.3 Test your Knowledge (Question):What do you think of the statement?Why some Projects are considered as "White Elephants". Explain Please help! Worth 60 points for the rapid reply- Find the slopes of each side of the quadrilateral. Also, what is the most accurate classification for the quadrilateral? Rhombus, Trapezod, or Kite. Calculate the net force on particle q1.Now use Coulomb's Law and electric constant tocalculate the force between q and q3.F = -14.4 N+13.0 Cq10.25 mq1q32F2 = ketke = 8.99 10r = 0.55 m+7.70 C+q2F = +[?] N0.30 m-5.90 Cq3Enter A gas turbine power plant operating on an ideal Brayton cycle has a pressure ratio of 11.6. The inlet to the compressor is at a pressure of 90kPa and a temperature of 320K. Assume air-standard assumptions, an isentropic compressor, but variable specific heats. Determine the work required, per unit mass of air, to drive the compressor. Enter the answer as a positive value, expressed in units of kJ/kg, to 1 dp [Do not include the units] Cody invested the profit of his business in an investment fund that was earning 3.50% compounded monthly. He began withdrawing $4,500 from this fund every 6 months, with the first withdrawal in 3 years. If the money in the fund lasted for the next 5 years, how much money did he initially invest in the fund? $ Use the Born-Haber cycle to determine the lattice energy of lithium fluoride use the following information: Standard energy of formation of lithium fluoride: -617 kJ/mol Energy of sublimation of lithium: 161 kJ/mol First ionization energy of lithium: 520 kJ/mol First electron affinity of fluorine: -328 kJ/mol Bond dissociation energy of fluorine: 154 kJ/mol a. Draw the cycle and for each step include the species present in the directions that represent the reactions that are occurring b. Show the reaction that represents the lattice energy of lithium fluoride. I c. Calculate the lattice energy of lithium fluoride d. Look up possibly online the lattice energy of sodium fluoride and in two to three sentences explain the difference. Your explanation should include concepts such as atomic size and shielding. Include the value of the network energy and the reference from where you obtained it..