ozone is a gas the has the chemical formula O3 and it’s a gas that we can breathe

true or false

Answers

Answer 1

Answer:

False

Explanation:

When inhaled, ozone can damage the lungs. Relatively low amounts can cause chest pain, coughing, shortness of breath and throat irritation. Ozone may also worsen chronic respiratory diseases such as asthma and compromise the ability of the body to fight respiratory infections.


Related Questions

Why are the ddNTPs fluorescently labeled?

Answers

Answer :

Labeling either the DNA sequencing primers or the individual nucleotides with a radioactive or fluorescent tag enables this visualization. In automated sequencing, the ddNTPs are labeled with fluorescent dyes that are detected by a scanner. This makes it possible for all four reactions (dGTP, dATP, dCTP, and dTTP) to be run in one lane, so you can have huge numbers of reactions on one gel.

What is transport in humans and plants and what is the difference?

Answers

Answer:

In humans the transport system occurs through vein, artery and capillaries. Whereas, in plants , it occurs through the xylem vessels, tracheids and phloem sieve tubes.

Explanation:

TACAGGATCATTTCGCGAACGGAGCCGAACT
1. Convert this DNA to Pre mRNA, mRNA, and tRNA

Answers

AUG UCC UAG UAA AGC GCU UGC CUC GGC CUU GA(?) last letter there is gone

A component with a lower flavor threshold will make a bigger contribution to the character of the beer. True or False?

Answers

A component with a lower flavor threshold will make a bigger contribution to the character of the beer. True

A component with a lower flavor threshold means that it can be detected at lower concentrations, and therefore, can make a bigger contribution to the overall flavor profile of the beer.

For example, compounds like isoamyl acetate, which gives banana-like flavor, and diacetyl, which gives a buttery flavor, have low flavor thresholds and can be perceived even at low concentrations. Therefore, a small amount of these compounds can have a noticeable impact on the taste and aroma of the beer.

Learn more about lower flavor

https://brainly.com/question/17515899

#SPJ4

which atomic particles are in a unique cloud outside of the nucleus of the atom?

Answers

The nucleus of an atom is surrounded by a cloud of electrons. Remember, electrons are negatively-charged and are attracted to the positively-charged protons in the nucleus.

The fundamental unit of matter is thought to be the atom. Atoms are the building blocks of all objects with mass, or those that take up space. We now know that each atom is often made up of smaller particles, despite the fact that its original term referred to a particle that couldn't be further divided—the tiniest thing that was possible. They are frequently called subatomic particles because they are the building blocks of atoms. Three subatomic particles exist: protons, neutrons, and electrons.

Protons and electrons are the two subatomic particles with electrical charges. Protons have a positive charge, while electrons have a negative charge. In contrast, neutrons lack a charge. A basic tenet of physics is that charged particles repel one another while charged particles attract one another. Protons and electrons are therefore drawn to one another, much like the poles of a magnet. Protons are attracted to other protons and electrons are attracted to other electrons, much like when you try to push the same ends of two magnets together and encounter resistance.

To know more about electrons click here:

https://brainly.com/question/1255220

#SPJ4

telophase and cytokinesis is a step of mitosis. what key event happens during telophase and cytokinesis?

Answers

Telophase and cytokinesis are both steps in mitosis. The key events that happen during telophase and cytokinesis are formation of the nuclear envelope, formation of the contractile ring, division of the cytoplasm

The nuclear envelope starts to reform around each set of chromosomes, it does this by gathering membrane vesicles from the Golgi apparatus and other membranes within the cell. Formation of the contractile ring, this occurs only in animal cells, and is the beginning of the cytokinesis process. The contractile ring is made of actin and myosin, two proteins that contract like muscle tissue to "pinch" the cell membrane and divide the cell in two.

Division of the cytoplasm, once the nuclear envelope is fully formed and the contractile ring is in place, the cell begins to divide into two daughter cells. This is accomplished by the contraction of the contractile ring, which pulls the cell membrane inward to create a small "cleavage furrow."  The cleavage furrow deepens and ultimately divides the cell in two. The end result of telophase and cytokinesis is the creation of two identical daughter cells, each with a full complement of genetic material from the parent cell.

Learn more about  cytokinesis at:

https://brainly.com/question/29765124

#SPJ11

a decision tree is read from left to right, with the conditions along the various branches and the actions at the far left.true or false

Answers

The statement "a decision tree is read from left to right, with the conditions along the various branches and the actions at the far left" is False.

A decision tree is read from left to right, but the conditions are usually represented as nodes or circles, and the actions or outcomes are represented as branches or lines. The conditions are evaluated at each node, and based on the outcome of that evaluation, the tree branches off to the next node, and so on until an action or outcome is reached.

The branches are typically labeled with probabilities or expected values, and the goal of the decision tree is to identify the optimal decision or course of action based on the available information and the desired outcome.

To learn more about decision tree refer to:

brainly.com/question/30673588

#SPJ4

Different forms of the same element with different numbers of neutrons are called:
a. molecules
b. compounds
c. isotopes
d. lattices

Answers

Answer: c. isotopes

Explanation:

maybe sorry if wrong

a bacterial species differs from a species of eukaryotic organisms in that a bacterial species group of answer choices does not breed with other species. breeds with its own species. can be distinguished from other bacterial species. is a population of cells with similar characteristics. has a limited geographical distribution.

Answers

"A bacterial species differs from a species of eukaryotic organisms in that a bacterial species does not breed with other species."

A bacterial species does not interbreed with other species, but will only breed with its own species. This is different from a species of eukaryotic organisms, which may be able to breed with other species. Additionally, bacterial species can be distinguished from other bacterial species based on characteristics such as morphology, genetic makeup, and metabolic characteristics. Bacterial species also typically have a limited geographical distribution.

Learn more about bacterial species: https://brainly.com/question/8695285

#SPJ11

mendel's understanding of the inheritance of traits in peas mendel's understanding of the inheritance of traits in peas, expressed in modern language, included: check all that apply.

Answers

Mendel's understanding of the inheritance of traits in peas, expressed in modern language, include: The law of segregation, The law of independent assortment, The law of dominance

What is inheritance?

Inheritance refers to the passing of genetic material (traits) from one generation to the next. Inherited characteristics are determined by genes, and they can either be visible or not.

Mendel's discovery is the foundation of genetics as we know it today. This is because Mendel developed the first system for predicting inheritance, demonstrating that certain characteristics are transferred from one generation to the next.


The law of segregation,
which states that the two alleles of a gene separate into different gametes when a plant produces gametes (sex cells).
The law of independent assortment, which states that each pair of alleles segregates independently during gamete production.
The law of dominance, which states that a dominant allele will always be expressed in the phenotype of the organism.

To know more about inheritance of traits refer here:

https://brainly.com/question/22686199#

#SPJ11

Can someone help me with this question please

Explain why there is no set number of mutations that always result in cancer.

Answers

Answer:

There is no set number of mutations that always result in cancer because the development of cancer is a complex process influenced by many factors. Cancer can arise from mutations in many different genes that affect the regulation of cell growth and division, DNA repair mechanisms, and other important cellular processes. Additionally, the accumulation of mutations can be influenced by external factors such as exposure to carcinogens like tobacco smoke, radiation, or certain chemicals, as well as by lifestyle factors like diet and physical activity.

Some mutations may have little effect on the development of cancer, while others may be critical drivers of the disease. The number and type of mutations required for cancer to develop can vary depending on the type of cancer, the individual's genetic makeup, and other factors such as exposure to environmental factors or lifestyle choices. Therefore, there is no set number of mutations that always result in cancer, and the development of cancer is a complex and multifactorial process.

What happens after glycolysis but before citric acid cycle?

Answers

I think it’s oxidative phosphorylation when in presence of oxygen.

which process is based on dna recombination? homologous recombination bacterial conjugation all of these dna repair crossover

Answers

Crossover is the process based on DNA recombination.

The process of recombining the genetic material of two parents to create a new combination of genes is known as recombination. DNA recombination is a technique that enables cells to exchange genetic material, allowing for the exchange of genetic information. Homologous recombination, bacterial conjugation, and crossover all involve DNA recombination.

Homologous recombination is a DNA repair process that occurs in cells that have experienced DNA damage. It's a procedure that entails the transfer of genetic material from one DNA molecule to another. The procedure is most common in cells that have stopped dividing or have stopped dividing altogether.

Homologous recombination is a very effective mechanism for repairing DNA damage, and it is commonly used by cells to repair double-strand breaks. Bacterial conjugation is a process that allows bacteria to transfer genetic material, such as plasmids, from one bacterial cell to another. Bacteria use this mechanism to transmit genetic material between cells, allowing them to pass on beneficial traits like antibiotic resistance.

Crossover is a DNA recombination mechanism that occurs during meiosis. The chromosomes' maternal and paternal copies swap genetic information during this process, resulting in new combinations of genes in the offspring's cells. Crossover is responsible for the genetic diversity of the offspring and is a critical component of evolution.

Learn more about DNA: https://brainly.com/question/16099437

#SPJ11

Question 6
Skeletal muscles work with bones to give your body:
Strength
The ability to move
Strength and the ability to move
O None of the above

Answers

Strength and ability to move

the body compartments that participate in the immune system, after the formation of immune cells, are the . multiple select question. extracellular fluid mononuclear phagocyte system ciliary escalator bloodstream gastrointestinal lumen bone marrow cerebrospinal fluid lymphatic system

Answers

The body compartments that participate in the immune system, after the formation of immune cells, are the lymphatic system, extracellular fluid, mononuclear phagocyte system, and bloodstream.

What is the specific role of the immune system?

The specific role of the immune system refers to the finish with pathogenic agents such as microorganisms or viruses, which depend on the presence of specialized cells and organs.

Therefore, with this data, we can see that the specific role of the immune system is to fight against bacteria and viruses to maintain a health state.

Learn more about  the immune system here:

https://brainly.com/question/15595309

#SPJ1

what are the two ways the video mentions that invasive species can be introduced into aquatic ecosystems? a) on ship hulls and in large aquariums b) on ship hulls and through hitchhikers c) in ballast water found in ships and through fish farm nets d) in ballast water found in ships and as bait in commercial fishing expeditions please select the best answer from the choices provided a b c d

Answers

Invasive species can be introduced into aquatic ecosystems through a variety of pathways, but the video mentions two specific ways.

The first way is through ballast water found in ships, which is water taken on board to stabilize the vessel during travel. When the ship reaches its destination, this ballast water is discharged along with any organisms it may contain, including potential invasive species. This is a common pathway for the introduction of aquatic invasive species.

The second way is through the use of live bait in commercial fishing expeditions. Live bait can contain non-native species that can be introduced into new environments if they are not properly disposed of. This pathway is often overlooked but can be an important source of invasive species in aquatic ecosystems.

Therefore, the correct answer is d) in ballast water found in ships and as bait in commercial fishing expeditions.

To learn more about aquatic ecosystems visit;

https://brainly.com/question/4967501

#SPJ4

the term for a specific molecule on which an enzyme acts is the

Answers

The term for a specific molecule on which an enzyme act is a substrate. Substrates are molecules that enzymes bind to and catalyze reactions on.

Enzymes are organic catalysts that are produced by living organisms. Enzymes are biocatalysts that speed up the rate of biochemical reactions within the cell, they are biologically active and necessary for the survival of the organism. A substrate is a particular molecule that binds to an enzyme's active site and is transformed by a reaction.  The enzyme-substrate interaction is determined by the precise shape of the active site, as well as the shape and charge distribution of the substrate.

Learn more about substrate: https://brainly.com/question/4047091

#SPJ11

What is the significance of the crossing over that occurs between Nonsister chromatids during meiosis?

Answers

The significance of crossing over is the creation of new combinations of genetic material in offspring.

Crossing over occurs during meiosis when non-sister chromatids exchange segments of DNA. As a result, the offspring inherit a unique combination of genetic information from their parents. Crossing over promotes genetic diversity by creating new combinations of alleles that can contribute to the survival of populations under changing environments.

It also helps to explain why siblings may look different from each other, even when they have the same parents. Furthermore, crossing over can help to prevent the accumulation of harmful mutations by shuffling genetic material in a way that allows natural selection to act more effectively.

To learn more about Crossing over, here

https://brainly.com/question/19671756

#SPJ4

Which of the parent cells can transmit the changed DNA to the offspring?

Answers

Through the process of cell division and reproduction, any parent cell that experiences a change in its DNA (genetic material) has the potential to pass the altered DNA to its offspring.

The egg cell (female gamete) and the sperm cell (male gamete) are the two parent cells in sexual reproduction, and they each provide the baby with half of its genetic makeup. An alteration in the DNA of either the egg or the sperm cell, such as a mutation, can be passed on to the progeny.

Asexual reproduction creates identical children by dividing the parent cell. Before dividing, if the parent cell goes through a DNA alteration, this DNA change will be present in both the parent cell and the child.

The type and magnitude of the DNA mutation, as well as other parameters including the progeny's viability and survival, all play a role in determining whether altered DNA is transmitted to offspring during sexual and asexual reproduction.

To know more about cell division,

https://brainly.com/question/29773280

#SPJ4

Which Leu codon can be converted to either Ser, Val, or Met by a single nucleotide substitution?
CUA
CUU
CUC
CUG

Answers

The Leu codons are CUA, CUU, CUC, and CUG. Of these, the CUA codon can be converted to either Ser, Val, or Met by a single nucleotide substitution.

Specifically, a CUA to UCA (Ser), CUA to GUA (Val), or CUA to AUG (Met) substitution would result in a different amino acid being incorporated into the protein sequence.

The other Leu codons (CUU, CUC, and CUG) have different nucleotide sequences and would require multiple nucleotide substitutions to be converted to Ser, Val, or Met codons.

The ability of the CUA codon to be converted to multiple different amino acids by a single nucleotide substitution is an example of genetic code degeneracy or redundancy.

This is because there are more codons (64) than there are amino acids (20), so some amino acids are coded for by multiple different codons. In the case of Leu.

To learn more about Leu codons here:

https://brainly.com/question/30367265

#SPJ11

6. which location might have large fish kills that is not associated with nutrient pollution if containment of the pollutant is not sufficient. explain.

Answers

The location might have large fish kills that is not associated with nutrient pollution if containment of the pollutant is an oil spill.

Oil spills can lead to fish kills because they block sunlight and oxygen exchange at the surface of the water and they also cause a reduction in oxygen levels because bacteria consume the oil and use up the oxygen in the process. These conditions can make it impossible for fish and other marine life to survive. Other possible factors that can lead to large fish kills include algae blooms occur when there is an excessive growth of algae in the water. The algae consume the oxygen in the water, leading to a decrease in oxygen levels that can be deadly for fish.

Wastewater that is high in organic matter can also lead to fish kills. Bacteria in the water consume the organic matter and use up the oxygen in the process, leading to a decrease in oxygen levels that can be deadly for fish. Extreme weather conditions such as drought, heatwaves, and cold snaps can also lead to fish kills. For example, when the water temperature is too high, fish may become stressed and die. Conversely, when the water temperature is too low, fish may become sluggish and vulnerable to predators.

Learn more about oil spill at:

https://brainly.com/question/1307422

#SPJ11

observe your frog heart after it has been removed. did it continue to beat? how? what else did you learn from your frog? anatomy? physiology? did you do any further tests? please elaborate. g

Answers

Yes, the frog heart continued to beat after it had been removed. This is due to the intrinsic excitability of the myocardium, or muscle tissue in the heart. This intrinsic excitability means that the heart can continue to beat without any external input from the nervous system.

From observing the frog heart, we can learn about anatomy and physiology. Anatomy refers to the structure and physical form of the heart. We can see the size and shape of the heart and the blood vessels entering and leaving it. Physiology is the function and processes of the heart. We can observe how the heart beats and pumps blood.

Further tests could include a detailed analysis of the heart rate. This could involve measuring the heart rate over time, looking for any changes in rate, or measuring the heart rate under various conditions. Additionally, one could measure the electrical activity of the heart by using an electrocardiogram. This would involve placing electrodes on the heart and measuring the electrical impulses.

In conclusion, by observing the frog heart we can learn about both anatomy and physiology and also explore other tests to gain a deeper understanding of the heart’s function.

For more such questions on Frog heart.

https://brainly.com/question/11126450#

#SPJ11

a black haired true breeding guinea pig is crossed with a white haired true breeding guinea pig. all of the offspring have black hair.

a. which color is dominant?
b. what are the genotypes and phenotypes of the parents?
c. what are the genotypes and phenotypes of the offspring?

Answers

a. Their phenotypes are black-haired and white-haired, respectively.

b. The genotype and phenotype of all offspring are BB and black-haired, respectively.

c. All of the offspring have black hair, so they must all have the genotype BB.

What are the genotypes and phenotypes of the parents?

In this case, we can infer that black hair color is dominant over white hair color since all offspring have black hair.

Since they are both true breeding, their genotypes are homozygous dominant and homozygous recessive, respectively. Therefore, the genotypes of the parents are BB and bb. Their phenotypes are black-haired and white-haired, respectively.

Let's denote the black-haired true breeding guinea pig as BB and the white-haired true breeding guinea pig as bb.

Therefore, the genotype and phenotype of all offspring are BB and black-haired, respectively.

Learn more about genotype here: https://brainly.com/question/902712

#SPJ1

1. The steps of the carbon cycle are described below.
Place the steps in the correct order.
a. Animals and plants release carbon dioxide and
water as a result of cellular respiration.
b. Carbon dioxide is released by plants and animals
and moves into the biosphere.
c. Plants use water and carbon dioxide from the
atmosphere to make sugar and oxygen through
the process of photosynthesis.
d. Animals and plants use sugar and oxygen for the
process of cellular respiration.
e. Cellular respiration transforms sugar and oxygen
into carbon dioxide and water.

Answers

Answer:

1. Plants use water and carbon dioxide from the atmosphere to make glucose and oxygen through photosynthesis.

2. Animals and plants use glucose and oxygen for cellular respiration

3. Cellular respiration transforms glucose and oxygen into carbon dioxide and water.

4. Animals and plants release carbon dioxide and water as a result of cellular respiration.

5. Carbon Dioxide is released by plants and animals and moves in the biosphere

Explanation: CO2 + H2O with energy (sun) = C6 H12 O6 + O2

ddNTPs are labeled with fluorescent dyes in order to differentiate between the different nucleotides. True or False?

Answers

The given statement "ddNTPs are labeled with fluorescent dyes in order to differentiate between the different nucleotides" true. because ddNTPs (dideoxynucleotides) are used in Sanger sequencing to terminate DNA synthesis, allowing for the determination of the nucleotide sequence of a DNA fragment.

To differentiate between the different nucleotides, ddNTPs are labeled with different fluorescent dyes, each of which emits a unique wavelength of light. The fluorescent signal emitted by the ddNTPs is detected by a laser during sequencing, allowing for the identification of the nucleotide sequence of the DNA fragment.

Therefore, labeling ddNTPs with fluorescent dyes is an important part of Sanger sequencing. SO, The given statement is true.

To learn more about nucleotides

https://brainly.com/question/13185536

#SPJ4

two proteins interact to form a multimeric complex. when one of the proteins is mutated, there is a substantial loss of functional activity in the multimeric protein. this type of mutation is classified as .

Answers

When one of the proteins is mutated, there is a substantial loss of functional activity in the multimeric protein. This type of mutation is classified as a loss-of-function mutation.

What is a loss-of-function mutation?

A loss-of-function mutation is a type of genetic mutation in which a gene's normal function is impaired or eliminated. This type of mutation can lead to a decrease or complete loss of protein function in the body. It might result in the inability to produce a protein or the production of a defective protein, both of which can have consequences for normal biological function. The severity of loss-of-function mutations can differ, depending on the importance of the protein and the extent of the mutation.

To sum up, when one of the proteins is mutated, there is a substantial loss of functional activity in the multimeric protein. This type of mutation is classified as a loss-of-function mutation.

Learn more about mutation: https://brainly.com/question/14438201

#SPJ11

16. A farm has a bluish-gray color Andalusian fowl, but doesn't want anymore of that color of bird. Which color of bird
would be best for the farmer to breed the bluish-gray Andalusian fowl with in order to have the lowest chance of having offspring that are bluish-gray? Why?

Answers

Black (BB) and white (B'B') individuals are homozygous in Andalusian fowls. An homozygous white bird and a heterozygous black bird are crossed. All of the progeny are bluish grey.

What causes Blue Andalusian birds to exist?

The Blue Andalusian fowl's plumage phenotype is the consequence of heterozygosity again for expanded black (E) gene combined with the blue (Bl) mutant (for a review, see Smyth, 1990). Heterozygotes' feathers have such a slate blue colouring as a result of the Bl gene's alteration of the normal synthesis of black pigment.

What kind of hens are Blue Andalusian?

According to the Standard of Perfection, the Blue Andalusian should have white earlobes, smooth legs, or a single comb. Each feather should also be clearly interwoven with a dark blue or black. Male Section and click have an upright comb, whilst mature hens typically have a bigger comb which flops to one side.

To know more about heterozygous visit:

https://brainly.com/question/30622664

#SPJ1

the sequence of amino acids determines the __ protien which determines the protiens__

Answers

Answer:

The sequence of amino acids determines the primary structure of a protein, which determines the protein's higher-order structure, function, and properties.

The primary structure is the linear sequence of amino acids in a protein, which is stabilized by peptide bonds. The specific sequence of amino acids determines the protein's overall shape and how it interacts with other molecules.

The higher-order structure of a protein includes its secondary, tertiary, and quaternary structures, which are determined by various interactions between amino acids such as hydrogen bonds, disulfide bonds, and hydrophobic interactions.

The protein's function and properties are determined by its structure, and this can include enzymatic activity, transport of molecules, signaling, and structural support. Therefore, the sequence of amino acids is critical to the overall function and properties of a protein.

The amino acid sequence of a polypeptide chain defines the protein's ultimate 3D shape. Protein structure is classified into four levels: primary structure, secondary structure, tertiary structure, and quaternary structure. Furthermore, there are two types of 3D protein structures: spherical proteins and filamentous proteins. The information contained in the cellular genetic code determines the amino acid structure of a protein. The sequence of amino acids in a polypeptide chain is distinctive to each protein. A single amino acid change produces a DNA mutation, which usually results in a non-functioning protein. The "R" group changes between amino acids and dictates how these protein monomers vary. The information contained in the cellular genetic code determines the amino acid structure of a protein. The pattern of nucleotide bases in nucleic acids (DNA and RNA) that codes for amino acids is known as the genetic code. Proteins are made up of molecules called amino acids. A protein is composed of one or more straight strings of amino acids, each of which is referred to as a polypeptide. There are several types of amino acids that are frequently present in proteins.

Which type of valve opens in response to increasing pressure in the ventricles?

Answers

The type of valve opens in response to increasing pressure is semilunar valves.

Semilunar valve, one of two pocket-like, half-moon-shaped organs that connect the heart's left and right ventricles to the aorta (aortic valve) and pulmonary artery, respectively. The semilunar valves allows blood to flow into the arteries from the ventricles and prohibit the backward flow of blood from the arteries into the ventricles.

The endocardium, a thin, smooth membrane, and connective tissue make up the semilunar valves. The atrioventricular valves, which are situated halfway between the atrium and the ventricle, cooperate with them in order to function. The audible pulse is connected to the closure of the heart valves. The atrioventricular valves close first, followed by the pulmonary and aortic semilunar valves, which produce the second sound.

Learn more about Semilunar valves:

https://brainly.com/question/14481540

#SPJ4

Need help asap please :(

Answers

Answer:

picture quality is low

Explanation:

write your question

Other Questions
In what ways Western traders and immigrants give to Oceanic societies and governments?Select all that apply.ResponsesMissionaries converted Pacific Islanders to Christianity. They provided native chiefs with guns and weaponry.Businessmen introduced the concepts of loans and credit. They brought grain-based agriculture and cuisine to the region. What would you see when titrating if an indicator was not added? - no color change would occur; it would not be clear when the equivalence point was reached- a color change would still occur; it would not be clear when the equivalence point was reached - a color change would still occur, the equivalence point would still be identifiable- no color change would occur; the equivalence point would still be identifiable Please help me with this form.Premium Court pays District of Columbia (DC) unemployment tax and makes the required deposits of both federal and state unemployment taxes on a timely basis.DC applies a rate of 0.7 percent to the first $9,000 of wages per employee and thus Premium Court paid state unemployment taxes of $496.30 to DC in 2022. DC is not subject to a credit reduction and there was no overpayment of FUTA in 2021. Use this information to complete Parts 1-4 (as necessary) of Form 940. weiss company purchased two identical inventory items. the first purchase cost $20 and the second cost $24. the company sold one of the items for $37. if the company uses the lifo cost flow method, the balance in the inventory account after the sale transaction will be: I WILL GIVE 35 POINTS TO THOSE WHO ANSWER THIS QUESTION RIGHT NOOOO SCAMS A system releases 8.8 kJ of heat while 6.7 kJ of work is done on it. Calculate E. 2. Complete the sentences with the correct passive form of the verbs in brackets. Use the Past Simple. a. My car (repair) last week. b. This song C. d. The film e. When f. The car g. The original building. h. Where i. When (not write) by John Lennon. (the phone/answer) by a young girl? (make) ten years ago. (tennis/invent)? (not damaged) in the accident. (pull) down in 1965. (this pot/make)? (this bridge/build)? 02.02 Language in King's LetterDirections: Martin Luther King, Jr.'s "Letter from Birmingham/Jail" includes many examples of figurative language meantto persuade people to take action. Read the lines from the letter and identify ONE type of figurative language (someexcerpts may contain more than one), its meaning, its effect on mood and tone, and its effect on the audience. An examplehas been completed for you. Then, answer the analysis question.The meaning:The line... from "Letter fromBirmingham Jail"Example:This movement is nourished by thecontemporary frustration over thecontinued existence of racialdiscrimination.1....when you suddenly find yourtongue twisted and your speechstammering as you seek toexplain to your six-year-olddaughter why she can't go to thepublic amusement park that hasjust been advertised on televisionand see the tears welling up in herlittle eyes when she is told thatFuntown is closed to coloredchildren, and see the depressingclouds of inferiority begin to formin her little mental sky...Type offigurativelanguage:PersonificationSimileThe tone used in theexample and its effecton the audience:The movement grows (like a The factual tone allows theperson grows when fed) audience to see the civilbecause of the people'sfrustration with racialdiscrimination.rights movement as a livingthing, which would make itmore meaningful. who is better Olix or Hazem Which best describes carbon dioxides path out of the body? a. nose pharynx larynx trachea bronchus alveoli b. alveoli trachea bronchus larynx pharynx nosec. alveoli bronchus trachea larynx pharynx nosed. nose larynx pharynx trachea bronchus alveoli Carissa conducts an experiment by rolling two number cubes,both numbered 1-6.She records the number of times she rolls the same number on both cubes.In 50 trails , she rolls the same number on both cubes 13 times,Based on results what is the probability of rolling the same number on both cubes expressed as percent? 5x2+x=9+3x+10 what is x which type of body language appears to most help us establish relationships? Jake thinks of a number. He adds 5 then multiplies the result by 2. The answer is the same as 5 times the number then take away 14. what number did Jake think of? specific goals produce a higher level of output than does the generalized goal of do your best. true/false A mystery compound is a liquid with a boiling point of 50 degrees Celsius. Is it like likely to be an ionic compound? Why or why not. boyce industries, a manufacturing corporation, has accumulated earnings of $325,000 and cannot show any reasonable need for the accumulated earnings. what is boyce's accumulated earnings tax? a.$75,000 b.$0 c.$15,000 d.$13,750 Oxygen helps your body produce more A. ATP. B. cortisol. C. AMV. D. ADP. Can someone solve this for me please 4x+y=-2;3x-y=-12 15 points to answer please help I don't get it....