Point B (8, -3) has been transformed. After a reflection over the x-axis, what is the coordinate of point B’?

Answers

Answer 1

The coordinate of point B' is (8, 3) after reflecting point B (8, -3) over the x-axis.

What is Reflection in geometry?

A reflection is an involution: when applied twice in succession, every point returns to its original location, and every geometrical object is restored to its original state.

When a point is reflected over the x-axis, its y-coordinate changes sign while its x-coordinate remains the same.

Therefore, to find the coordinates of point B' after reflecting point B over the x-axis, we simply need to change the sign of the y-coordinate of point B.

Starting with point B at (8, -3), reflecting over the x-axis changes the sign of the y-coordinate, so the new point B' is at:

B' = (8, 3)

Therefore, the coordinate of point B' is (8, 3) after reflecting point B (8, -3) over the x-axis.

To learn more about Reflection, click on the link:

https://brainly.com/question/16956113

#SPJ1


Related Questions

100 points please I need this for my grade

Answers

First box is x^2 second is 5x third box is 3x last box is 15

Step-by-step explanation:

blue box is x^2

orange box is 5x

yellow box is 3x

green box is 15

PLEAASE ANSWER QUICKLY I NEED HELP!!!! I WILL GIVE BRAINLIEST

Which of these equations is NOT true?

A. -3 (5-4) + -3(5) - 4

B. -5+ (-4) + -4 + (-5)

C. -3 + (5-4) = (-3+5) - 4

D. -5 - 4 = -5 + (-4)

Answers

Step-by-step explanation:

The first two are not equations, there is no ' = ' sign. Tey are expressions.

C) -3 + (5-4) = ) (-3+5) -4

     -3 +1   = 2 -4

         -2    = -2       True

D)  -5 -4 = -5 +( -4)

        -9    =   -9      True

I will assume the + sign is supposed to =   ( same key)

A)   -3 (5-4)  = -3(5) - 4

       -3  = -19     FALSE

B)  -5 + (-4) =  -4 + (-5)

        -9       =   -9    True

Make x the subject of the formula.
A-x=xr/t​

Answers

[tex]A-x=\cfrac{xr}{t}\implies At-xt=xr\implies At=xt+xr \\\\\\ At=x(t+r)\implies \cfrac{At}{t+r}=x[/tex]

make x the subject means write all terms in terms of x

look at attachment.

Dylan was out at a restaurant for dinner when the bill came. His dinner came to 32. He wanted to leave a 15% tip. How much was his meal plus the tip,before tax,in dollars and cents

Answers

[tex]\begin{array}{|c|ll} \cline{1-1} \textit{\textit{\LARGE a}\% of \textit{\LARGE b}}\\ \cline{1-1} \\ \left( \cfrac{\textit{\LARGE a}}{100} \right)\cdot \textit{\LARGE b} \\\\ \cline{1-1} \end{array}~\hspace{5em}\stackrel{\textit{15\% of 32}}{\left( \cfrac{15}{100} \right)32}\implies 4.8\hspace{5em}\underset{ \textit{meal \& tip} }{\stackrel{ 32~~ + ~~4.8 }{\text{\LARGE 36.8}}}[/tex]

1) Select the permutation that is the next one in lexicographic order after (4, 6, 2, 7, 3, 1, 5).
a. (4, 6, 2, 7, 3, 5, 1)
b. (4, 6, 2, 7, 5, 1, 3)
c. (4, 6, 2, 7, 1, 3, 5)
d. (4, 6, 3, 1, 2, 5, 7)
2) Select the 5-subset from {1, 2, 3, 4, 5, 6, 7, 8, 9} that is the next one in lexicographic order after {2, 3, 7, 8, 9}.
a. {2, 3, 7, 9, 8}
b. {2, 4, 5, 6, 7}
c. {2, 4, 5, 8, 9}
d. {2, 4, 7, 8, 9}

Answers

1) The permutation that is the next one in lexicographic order after (4, 6, 2, 7, 3, 1, 5) is (4, 6, 2, 7, 3, 5, 1). Therefore answer is a. (4, 6, 2, 7, 3, 5, 1).

2) The 5-subset from {1, 2, 3, 4, 5, 6, 7, 8, 9} that is the next one in lexicographic order after {2, 3, 7, 8, 9} is {2, 4, 7, 8, 9}. Therefore the answer is d. {2, 4, 7, 8, 9}.

The next permutation in lexicographic order is the one that comes immediately after the given permutation when the permutations are listed in numerical order. To find the next permutation, we need to find the rightmost pair of elements that are in decreasing order. In this case, that pair is (5, 1). We then need to find the smallest element to the right of 1 that is larger than 1, which is 3. We swap 1 and 3 to get (4, 6, 2, 7, 3, 5, 1).

To find the next 5-subset in lexicographic order, we need to find the rightmost element that can be increased. In this case, that element is 9. We then replace 9 with the smallest element to its right that is larger than 9, which is 4. We then need to rearrange the remaining elements in increasing order to get {2, 4, 7, 8, 9}.

To know more on lexicographic order

https://brainly.com/question/29855401

#SPJ4

D
O
1) Find the minimum and maximum values for the function with the given domain interval.
1
c(z) = √ã, given 121 ≤ x ≤ 17
minimum value=
1
-; maximum value = 17
121
minimum value=√17; maximum value=
1
11
1
minimum value= ; maximum value = √17
11
minimum value=none; maximum value=none

Answers

The answer is:

minimum value = √121/11 = 2/11

maximum value = √17/11

Here's how to solve it:

The given function is c(z) = √z, and the domain interval is 121 ≤ z ≤ 17.

The minimum value of the function occurs at the endpoint of the domain interval where the function takes the smallest value. In this case, the smallest value of the function occurs at z = 17, so the minimum value of the function is:

c(17) = √17

The maximum value of the function occurs at the endpoint of the domain interval where the function takes the largest value. In this case, the largest value of the function occurs at z = 121, so the maximum value of the function is:

c(121) = √121 = 11

Therefore, the minimum value of the function is √17 and the maximum value of the function is 11/√121, which simplifies to 1/11.

$240 is invested in an account earning 2.2% interest (APR), compounded
quarterly. Write a function showing the value of the account after t years,
where the annual growth rate can be found from a constant in the function.
Round all coefficients in the function to four decimal places. Also, determine
the percentage of growth per year (APY), to the nearest hundredth of a
percent.
Function: f(t)
Growth
=
% increase per year

Answers

Therefore , the solution of the given problem of percentage comes out to be  the account's yearly percentage yield (APY) is 2.24%.

What is percentage?

The abbreviation "a%" is used to indicate a value or number in statistics that is expressed as a percentage of 100. Versions with "pct," "pct," or "pc" as the initials are also rare. However, the most popular method to do this is to use the percentage symbol ("%"). Additionally, both hints nor a constant ratio of every element to the overall amount exist. Since numbers commonly add up to 100, they are essentially integers.

Here,

The following equation can be used to determine the worth of an account after t years, compounded quarterly:

=>  A = P * (1 + r/4)⁴ⁿ

When we enter the numbers, we obtain:

=>  A = 240 * (1 + 0.022/4⁴ⁿ

By condensing the solution, we obtain:

=>  A = 240 * 1.0055⁴ⁿ

Consequently, the following is the function displaying the account's worth after t years:

=>  f(t) = 240 * 1.0055⁴ⁿ

We can use the following formula to determine the yearly percentage yield (APY):

=> APY = (1 + r/n)ⁿ - 1

where r equals the 2.2% yearly interest rate.

n is the quantity of times interest is added annually. (4, since interest is compounded quarterly)

When we enter the numbers, we obtain:

=> APY = (1 + 0.022/4)⁴ - 1

APY = 0.02237 or 2.24% (rounded to the nearest hundredth of a percent)

As a result, the account's yearly percentage yield (APY) is 2.24%.

To know more about percentage visit:

https://brainly.com/question/28269290

#SPJ1

Which of the following is a ‘False’ statement.
(a) Two diameters of a circle will necessarily intersect.
(b) The centre of a circle always lies in the interior.
(c) The diameter is half of the radius of a circle.
(d) Longer chord is nearer to the centre of the circle.

Answers

Answer:

c) The Diameter is Half of the radius

Step-by-step explanation:

A) A diameter ALWAYS passes through the center of the circle, so EVERY diameter WILL pass through the Center of the circle, making this statement valid.

b) A center of a circle will ALWAYS lie in the interior of the circle. it is an Axiom

c) False, the RADIUS is half of the Diameter of a circle.

d) The Longest Chord IS the Diameter, which passes through the circle, so this statement is valid.

So the false option is (C)

Drag each tile to the correct box.
The table shows data on an airline's adherence to scheduled departure times over the weekend at an airport for 300 randomly selected flight
On Time
Total
142
210
56
90
198
300
Domestic Flights
International Flights
um. All rights reserved.
Total
Order the probabilities of the given events from least to greatest.
P(international | on time)
P(delayer domestic)
Delayed
68
34
102
<
P(on time and domestic)

Answers

Answer:

Step-by-step explanation:

P(international | on time)< P(delayed | domestic) <P(on time and domestic)

correct in plato

Find and interpret the zero of the rational function. Does this result make sense within the
context of the problem? Answer in complete sentences using proper grammar and correct
spelling.

Answers

Fiinding and interpreting the zero of a rational function involves solving for x when the function equals zero and understanding its significance within the context.

Hello! I understand you want to find and interpret the zero of a rational function, and I'd be happy to help.

The zero of a rational function occurs when the function's value is equal to zero. In other words, a zero is a value of x that makes the function f(x) = 0. To find the zero, you must set the numerator of the rational function equal to zero and solve for x.

It's important to note that the denominator should never equal zero, as this would make the function undefined.

Interpreting the zero helps us understand the behavior of the function and can be useful in various applications.

For instance, the zero might represent a break-even point in a business context or an equilibrium in a physical system. Whether the result makes sense within the context of a specific problem depends on the given scenario and the mathematical relationship between the variables.

To summarize,  Always ensure the denominator is never zero to maintain the function's validity.

To learn more about : interpreting

https://brainly.com/question/30178616

#SPJ11

Anna is draining her bathtub which currently as 45 gallons of water in it . it drains at a rate 7 gallons every three minutes. how many gallons will it have after 5 minutes of draining?

Answers

Answer:

Bathtub currently has 45 gallons of water.

It drains 7 gallons every three minutes.

How much gallons will it have after 5 minutes.

First, find how much it drains in one minute and multiply it by 5.

7 gallons per 3 minutes.

So 7/3 = 2.3333 or roughly 2 gallons per minute.

How many gallons will it have after 5 minutes of draining.

2*5 = 10 litres will have been drained.

So, 45 - 10 = 35 gallons of water would remain after 5 minutes of draining.

PLS HELP ASAP!!!!

Numerical - ? - $4000 = $500
Verbal - What minus four thousand equals 500?

Answers

Answer: lol 3500 minus 4000 equals 500

Step-by-step explanation:

:) there

What number is 11 less than a positive seven

Answers

Answer:

The answer is -5. To do this you first draw your number line and label it from +7 to -10. You then count from from seven till the 11th number which in this case it's -5

4023 base 5 + 3102 in base 5

Answers

Answer:

Step-by-step explanation:

To add numbers in base 5, we need to follow the same process as adding numbers in base 10. We will start by aligning the digits based on their place value and then add them up, carrying any remainders as necessary.

4023 base 5

3102 base 5

11325 base 5

Therefore, the sum of 4023 base 5 and 3102 in base 5 is 11325 base 5.

Riley was a spectator at his town's air guitar competition. Contestants were allowed to play either the acoustic or electric air guitar, but not both. Riley recorded which type of guitar each contestant played. He also counted the number of contestants wearing different kinds of pants, as there were some interesting stylistic choices.

What is the conditional probability that a randomly selected contestant played an acoustic guitar, given they wore leather pants?

show ALL step

Answers

The conditional probability that a randomly selected contestant played an acoustic guitar is 2/5.

What is conditional probability?

The possibility of an event or outcome happening contingent on the occurrence of a prior event or outcome is known as conditional probability. The probability of the prior event is multiplied by the current likelihood of the subsequent, or conditional, occurrence to determine the conditional probability.

Here, we have

Given: Riley was a spectator at his town's air guitar competition. Contestants were allowed to play either the acoustic or electric air guitar, but not both. Riley recorded which type of guitar each contestant played.

Let A be the event of a contestant playing acoustic guitar.

Let B be the event of a contestant wearing leather pants

The conditional probability of a contestant playing acoustic guitar given he wears leather pants, P(A|B) is-

P(A|B) = P(A∩B)|P(B)

Where,

P(A∩B) =  is the probability of simultaneous occurrence of events A and B.

P(A∩B) = 6

P(B) = no. of contestants wearing leather pants

P(B) = 15

P(A|B) = 6/15 = 2/5

Hence, the conditional probability that a randomly selected contestant played an acoustic guitar is 2/5.

To learn more about the conditional probability from the given link

https://brainly.com/question/10739947

#SPJ1

Find the outer perimeter.
18 ft
14 ft
10 ft
JROR)
P = [?] ft
Round to the nearest
hundredth.

Answers

Therefore, the outer perimeter is approximately 73.20 ft.

What is perimeter?

Perimeter is the total distance around the outside of a two-dimensional shape. It is calculated by adding up the lengths of all the sides of the shape. The units for perimeter are the same as the units used for the length of the sides. For example, if the sides are measured in feet, the perimeter will be measured in feet as well.

Here,

We need to find the outer perimeter, which means we need to find the perimeter of the shape that includes all the sides of JROP. To do this, we need to find the length of side JO.

Using the Pythagorean Theorem on right triangle JOR, we have:

JO² = JR² + OR²

JO² = 10² + 14²

JO² = 296

JO ≈ 17.20 ft

Now we can find the outer perimeter:

Outer perimeter = JP + PO + OR + RJ + JO

Outer perimeter = 18 + 10 + 14 + 14 + 17.20

Outer perimeter ≈ 73.20 ft

To know more about perimeter,

https://brainly.com/question/7720055

#SPJ1

25 points!!!
using the 30° 60° 90° Triangle Theorem solve for x
(leave it in simplest radical form)

Answers

Answer:

[tex]x = 5 \sqrt{3} [/tex]

Step-by-step explanation:

The base of a triangle, located in front of an angle of 30 degrees, is equal to half the hypotenuse:

y = 2 × 5 = 10

Now, we can find x by using the Pythagorean theorem:

[tex] {x}^{2} = {10}^{2} - {5}^{2} = 100 - 25 = 75[/tex]

[tex]x > 0[/tex]

[tex]x = \sqrt{75} = 5 \sqrt{3} [/tex]

please help! what is the area of the rhombus?

Answers

Step-by-step explanation:

Distance formula to find distance from O to Q is sqrt (306)

Distance from R to P = sqrt (34)

Diagonals ( found above) intersect at right triangles in a rhombus

  so you can break it into two right triangles of base = sqrt (306)

           and height sqrt (34)/2

    TWO triangles of area = 1/2 base * height

         TOTAL Area is then :     TWO * 1/2 ( sqrt(34)/2)* sqrt (306) = 51 units^2

1. What is a benefit of using normal
approximation for a binomial?
2. What is a detriment of using normal
approximation for a binomial?
3. What conditions do we need to meet to
approximate a binomial with a normal curve?

Answers

1. A table in a book showed binomial probabilities with a tiny value for n (let's say 20, for example). The binomial formula had to be used, which might be very challenging, to compute the probability for big values of n. The technique was made simpler by using the binomial distribution's normal approximation.

2. In a table in a book, binomial probabilities with a low value for n (let's say, 20) were shown. The binomial formula had to be used, which might be very challenging, to compute the probability for big values of n. The technique was made simpler by using the binomial distribution's normal approximation. Take a basic random sample from the population to calculate the normal approximation to the binomial distribution.

There are n independent trials, where n is a number.

Any trial has two possible outcomes: success or failure.

The likelihood of each trial being successful is p.

3. It is necessary for the normal distribution's shape and the binomial distribution to be identical. The values np and nq must both be greater than five in order to guarantee this (np>5 and nq>5; the approximation is better if they are both greater than or equal to 10).

Define approximation?

Just utilising a line to approximate the value of the function at a given position is what is meant by a function's linear approximation. We recall the idea of the tangent line as soon as we come across a curve (of a function) and a point on it. The value of the function at any point that is extremely close to the provided point can be estimated using the equation of the tangent line if we are able to identify the equation of the tangent line at the given point. Because it uses the tangent line, this idea is sometimes referred to as the tangent line approximation. It is also known as the linear approximation.

A table in a book showed binomial probabilities with a tiny value for n (let's say 20, for example). The binomial formula had to be used, which might be very challenging, to compute the probability for big values of n. The technique was made simpler by using the binomial distribution's normal approximation.

In a table in a book, binomial probabilities with a low value for n (let's say, 20) were shown. The binomial formula had to be used, which might be very challenging, to compute the probability for big values of n. The technique was made simpler by using the binomial distribution's normal approximation. Take a basic random sample from the population to calculate the normal approximation to the binomial distribution.

There are n independent trials, where n is a number.

Any trial has two possible outcomes: success or failure.

The likelihood of each trial being successful is p.

It is necessary for the normal distribution's shape and the binomial distribution to be identical. The values np and nq must both be greater than five in order to guarantee this (np>5 and nq>5; the approximation is better if they are both greater than or equal to 10).

To know more about approximation, visit:

https://brainly.com/question/14306940

#SPJ1

Help!!!!
Find CB
Find AC

Answers

Step-by-step explanation:

For RIGHT triangles such as this one:

sin (60) = opposite LEG/ hypotenuse =  sqrt(3) / 2  / CB       solve for CB

tan (60°) =  opposite LEG / adjacent LEG = sqrt(3)/2  / AC    solve for AC

O is the center of the regular nonagon below. Find its perimeter. Round to the nearest tenth if necessary. Answer: P = = O 7 units​

Answers

Therefore, the perimeter P of the nonagon is 19.5 units.

What is perimeter?

Perimeter refers to the total length of the boundary or the outer edge of a closed figure or shape. It is the sum of the lengths of all the sides or edges that enclose the shape.

Here,

Since O is the center of the regular nonagon, all the sides of the nonagon are equal in length. Let the length of one side of the nonagon be s. Then, the perimeter P of the nonagon is given by:

P = 9s

To find s, we can use the fact that the sum of the interior angles of a nonagon is given by (9-2)×180° = 1260°. Since the nonagon is regular, each angle is equal to 1260°/9 = 140°.

Consider the triangle OAB, where A and B are two adjacent vertices of the nonagon. Since O is the center of the nonagon, angle AOB is equal to 360°/9 = 40°. Also, angle OAB and angle OBA are equal to half of (180° - 140°) = 20°.

Therefore, angle AOB is isosceles, and we can use the cosine rule to find s:

cos(20°) = (s/2) / s

cos(20°) = 1/2

s = 2 / cos(20°)

Using a calculator, we get s ≈ 2.165. Therefore, the perimeter P of the nonagon is:

P = 9s

≈ 19.5 (rounded to the nearest tenth)

To know more about perimeter,

https://brainly.com/question/30458422

#SPJ1

Simplify. p/ab+2q/ac

Answers

Answer:

To simplify the expression p/ab+2q/ac, we need to find a common denominator for the two fractions in the denominator. The common denominator is abc.

Thus,

p/ab + 2q/ac

= p*c/abc + 2q*b/abc (multiplying the first fraction by c/c and the second fraction by b/b)

= pc/abc + 2qb/abc

= (pc + 2qb) / abc

Therefore, the simplified expression is (pc + 2qb) / abc.

Justin began studying the population of 2 small towns in 2015.

town A begins with 9,000 people and increases by 500 people each year.

town B begins with 8,000 people and increases by 9% each year.
in what year will town B have larger population than town A

Answers

Town B will have a larger population than Town A in the year 2019.

How to find increase in population?

To solve this problem, we can use a year-by-year approach to see when the population of town B surpasses that of town A.

Let's start with year 0 (2015):

Town A population: 9,000

Town B population: 8,000

In year 1 (2016):

Town A population: 9,500 (9,000 + 500)

Town B population: 8,720 (8,000 x 1.09)

In year 2 (2017):

Town A population: 10,000 (9,500 + 500)

Town B population: 9,504.8 (8,720 x 1.09)

In year 3 (2018):

Town A population: 10,500 (10,000 + 500)

Town B population: 10,360.232 (9,508.8 x 1.09)

In year 4 (2019):

Town A population: 11,000 (10,500 + 500)

Town B population: 11,292.653 (10,394.912 x 1.09)

From this calculation, we can see that in the year 2019, the population of Town B will be larger than that of Town A. Therefore, the answer is:

Town B will have a larger population than Town A in the year 2019.

To know more about Increase by percent visit:

brainly.com/question/13533684

#SPJ1

A sledding run is 280 yards long with a vertical drop of 18.5 yards. What is the angle of depression of the run?
thank you​

Answers

Answer:

approximately 3.84 degrees.

Step-by-step explanation:

The angle of depression is the angle between a horizontal line and the line of sight when looking downwards. We can use trigonometry to calculate this angle.

Let's draw a diagram to represent the situation:

A

/|

/ |

18.5/ | 280

/ |

/θ |

/_____|

B

Here, point A represents the top of the sledding run, point B represents the bottom of the run, and θ is the angle of depression we want to find.

We can see that AB is the hypotenuse of a right triangle, and the vertical drop of 18.5 yards is the opposite side. We can use the tangent function to relate the opposite side to the adjacent side, which is the horizontal distance of the run:

tan θ = opposite/adjacent

tan θ = 18.5/280

Now we can use a calculator to find the value of the tangent:

θ = tan^(-1) (18.5/280)

θ ≈ 3.84 degrees

Therefore, the angle of depression of the run is approximately 3.84 degrees.

What is the area of one of the blue half circles? HINT: Remember, Area = pi x radius squared. So you will need to use the 40 (this is the diameter so make sure you find the radius). Then since you only want a half circle, you will need to divide it by 2.

The school is going to put grass on both semicircles of the field. How much grass will they need to cover the entire circle? HINT: You found one of the circles in #1, you need both of them now.









What is the distance around one of the semicircles at either end of the soccer field? HINT: You need circumference, which is pi x d. So you will need 40 and pi. Since you only want one, you will need to divide by 2.












What is the distance around the inner lane of the track? (You will want to use circumference and then the length of the field). HINT: You need circumference, which is pi x d. So you will need 40 and pi (that will give you the circles and then you have both of the straight distances which are 100 each).



pls help

Answers

The straight sections each have a length of 100. So, the total distance around the inner lane of the track is 200 + 40pi units

The area of one of the blue half circles can be found using the formula:

Area = pi x radius squared.

The diameter of the circle is given as 40, so the radius is half of that, which is 20.

Therefore, the area of one blue half circle is:
Area = pi x [tex]\frac{20^{2} }{2}[/tex]

Area = 200pi square units
To cover the entire circle, we need both blue half circles. So the total area needed to be covered with grass is:
Total area = 2 x 200pi = 400pi square units
The distance around one of the semicircles at either end of the soccer field can be found using the formula: Circumference = pi x diameter.

Since the diameter is given as 40.

The circumference is:
Circumference = pi x [tex]\frac{40}{2}[/tex]

Circumference = 20pi units

To find the distance around the inner lane of the track, we need to add the lengths of the straight distances (which are 100 each) to the circumference of the two blue half circles.

The circumference of one blue half circle is 20pi, so the total distance around the inner lane of the track is:
Distance = 2 x 100 + 2 x 20pi

Distance = 200 + 40pi units

For similar question on total distance :

https://brainly.com/question/6516113

#SPJ11

For anyone looking for the right answer on acellus it’s 6 couldn’t comment on any of the other ones that asked this question but they are wrong

Answer is 6

Answers

Value of variable x in the proportion is 6.

Define fraction

A fraction is used to express a portion of a whole or a ratio of two values. It is a mathematical statement known as a fraction bar or vinculum that has a numerator and a denominator separated by a horizontal line. The denominator is the total number of pieces that make up the whole, whereas the numerator is the number of parts that are being taken into account.

Given proportion;

10/10+x=35/56

Cross multiplying the proportion, we get

10×56=35×(10+x)

Multiplying the values on both side, we get

560=350+35x

Taking 350 on left hand side,

560-350=35x

35x=210

Dividing the equation by 35, we get

x=210/35

x=6

Hence, value of x in the proportion is 6.

To know more about numerator, visit:

https://brainly.com/question/7067665

#SPJ1

A man get a monthly pay of x .his monthly rent is 800 after paying his rent,he is left with 2000.find the range of values of x

Answers

X-800=2000
Add 800 to both sides
X=2800

How many people were polled in the survey? help please..
40
450
35
600

Answers

Answer:

Step-by-step explanation:

35 is the answer because where it says frequency you have to add it all together.

35 trust me I’ve done it

Use the following results from a test for marijuana​ use, which is provided by a certain drug testing company. Among 143 subjects with positive test​ results, there are 20 false positive​ results; among 153 negative​ results, there are 4 false negative results. If one of the test subjects is randomly​ selected, find the probability that the subject tested negative or did not use marijuana.​ (Hint: Construct a​ table.)

Answers

The probability that the subject tested negative or did not use marijuana is approximately 0.57.

What is probability?

Probability is a branch of mathematics that deals with the study of random events and their likelihood of occurrence. It is a way of quantifying the uncertainty or randomness associated with an event or an experiment.

In the given question,

To solve this problem, we can construct a table that summarizes the given information:

We are given the following information:

There are 143 subjects with positive test results, of which 20 are false positives.

There are 153 subjects with negative test results, of which 4 are false negatives.

Using this information, we can fill in the table as follows:

The numbers in parentheses are the counts of subjects in each category.

To find the probability that the subject tested negative or did not use marijuana, we need to add the probabilities of the two mutually exclusive events:

Tested negative and did not use marijuana (True Negative): P(True Negative) = 149/296

Tested positive but did not use marijuana (False Positive): P(False Positive) = 20/296

Therefore, the probability that the subject tested negative or did not use marijuana is:

P(Tested Negative or Did not use marijuana) = P(True Negative) + P(False Positive)

= 149/296 + 20/296

= 169/296

≈ 0.57

So, the probability that the subject tested negative or did not use marijuana is approximately 0.57.

To know more about probability, visit:

https://brainly.com/question/30034780

#SPJ1

Your monthly insurance premiums include liability ($50), property damage ($40), medical ($15),
comprehensive ($40), and collision ($85). What is your total monthly premium to the nearest dollar?
OA. $230
OB. $290
OC. $320
OD. $380

Answers

Answer:

Step-by-step explanation:

50+40+15+40+85

=230

Other Questions
willis middle school participates in a school-wide positive behavior supports program. several students have been identified with repeated office referrals and suspensions. these students would fall into which level of the three-tiered model of intervention? Write a program that will read a file (data.txt). The file contains integer values. Theprogram will read the file and create a list. (Python) If triangle ABC has points A(2, -4) B(-3, 1) C(-2, -6) and you perform the following transformations, where will B' be?Reflection over the y-axis, rotation 90 clockwise, and translation (x + 2, y - 1)B'( , ) One more than two-thirds of a number is no less than 25 During a video about the Mayan civilization, you learn about a bright blue paint pigment that has not faded over time. The chemical composition of this paint pigment has allowed it to withstand not only natural elements, such as sun and rain, but also chemical solvents and acids. What paint did you MOST likely hear about? A. Maya blue B. stucco C. stela D. hieroglyphs you are attempting to interview a 20-year-old patient who brought her two young children with her to the office today she is a single mother who is pregnant with her third child and receives public assistance. how will this response impact your ability to be empathetic? in the context of the net promoter score (nps), which of the following is a difference between promoters and detractors? question 29 options: unlike promoters, detractors are customers who are associated with scores of 7 or 8. unlike promoters, detractors are satisfied customers who may switch to competitors. unlike promoters, detractors defect at higher rates. unlike promoters, detractors are less price sensitive. if you were asked to dissolve a solid into an aqueous solution, how could you speed this process up? how could you slow it down? listed below are a number of possible ways to alter the rate of this process. place them in the proper category. if you need help, think about putting sugar in your tea. items: add the solute in large chunks. add the solute slowly. increase the atmospheric pressure. stir or agitate the solution. if a restriction enzyme that recognizes ggcat and cuts between the two guanine residues is mixed with dna that has the sequence ccgattataatcccgcggcatattagggcgg, how many pieces would the resulting product be? which of the following would most directly interfere with sperm production? which of the following would most directly interfere with sperm production? use of synthetic steroids (testosterone) low sperm count interruption of sustentocytes' production of abp ingestion of a substance that mimicked inhibin How did US and Soviet nuclear arsenals compare? Use the equation in the example to find the number ofcups of water you need if you have 12 cups of flour. when carbonyl compounds are reduced with a reagent such as lialh4 or nabh4 and a new stereogenic center is formed, what will the composition of the product mixture be? 7The United States receives more immigrants than any other nation in the world. However, many countries, like Saudi Arabia and Australia, have a greater percentage of their population made up of immigrants. What does this information reveal about these countries? A. They have smaller populations than that of the United States. B. Their life expectancy is less than in the United States. C. They have more lenient immigration policies than those in the United States. D. They encourage immigrants to move there more than the United States does. why is less atp produced by anaerobic respiration than by aerobic respiration? anaerobic respiration does not make use of an electron transport chain. anaerobic respiration uses a final electron acceptor that is less electronegative than o2, which is used as the final electron acceptor in aerobic respiration. anaerobic respiration does not make use of the citric acid cycle. all of these answers are correct. macy does not like a few of the standard operating procedures adapted for the new project. however, she discussed the items with the team and told them that she realized she was in the minority and that she would adapt the new procedures to maintain smooth operations within the team. which conflict-handling mode did macy use? spicy dish, a large distributor of canned beans and salsa, is organized into four business units: (1) north america salsa, (2) north america legume, (3) latin america, and (4) europe and asia. what two types of departmentalization are illustrated in this example? question 8 options: Describe the cities of the Indus River Valley (Use atleast 3 details):3 4. Myron Security, Inc., had total sales for 1 year of $945,860. Their advertising expenses were $57,370. a. Estimate the percent advertising expenses were of total sales. How do u think readers responded to the William Travis letter