Really easy, giving you the answers, just match them up, thanks!

Really Easy, Giving You The Answers, Just Match Them Up, Thanks!
Really Easy, Giving You The Answers, Just Match Them Up, Thanks!

Answers

Answer 1

Answer:

why can u do this yourself ?

Step-by-step explanation:

are u ok r ur hands broken

Answer 2
Base of a sold- A special face of a solid

Cone- three-dimensional figure with a circular base and a curved surface that rises to a vertex

Pyramid- three-dimensional figure with a polygon as a base and all the other bases are triangles with a common vertex

Slant height- height of a lateral surface

Surface area- the total area of all the faces



Related Questions

(18 points) What is the approximate area of the circle shown below?

Answers

Answer:

A

Step-by-step explanation:

because if you put in the radius of 3.7 you get 43.01 and if you round that up you get 43 which is A

Please help! Will mark Brainly!

Answers

10 hot dogs and 5 hamburgers   your graph would be 2y:1x

[tex]\frac{2y}{1x}[/tex]

Please help!!!
Geometry

Answers

Answer:

MQ= 4        PQ=8

Step-by-step explanation:

Since PM and PQ are congruent, we know that MQ is 4 also. We can just double 4, and know that PQ is 8.

Brainliest to the first person with the written steps.

Answers

Answer:

x = 25

Step-by-step explanation:

2(3x - 4) = 5x + 17

6x - 8 = 5x + 17

x - 8 = 17

x = 25

Which is less, 3 or 30? Explain how you know

Answers

Answer:

3

Step-by-step explanation:

3 is closer to 0

5x-2y ≤ 20 can you guys solve this.

Answers


Your answer is y ≥ −10 + 5x/2

Answer:

Step-by-step explanation:

Let's solve for x.

5x−2y≤20

Step 1: Add 2y to both sides.

5x−2y+2y≤20+2y

5x≤2y+20

Step 2: Divide both sides by 5.

5x /5 ≤ 2y+20 /5

x≤ 2 /5 y+4

Answer:

x≤ 2 /5 y+4

Let's solve for y.

5x−2y≤20

Step 1: Add -5x to both sides.

5x−2y+−5x≤20+−5x

−2y≤−5x+20

Step 2: Divide both sides by -2.

−2y /−2 ≤ −5x+20

−2 y≥ 5 /2 x−10

Answer:

y≥ 5 /2 x−10

PLZ HELP! The equation is 7d+3n=85.

Answers

Answer:

Step-by-step explanation:

[tex]7d + 3n = 85 \\ 7d = 85 - 3n\\d = \frac{85}{7} - \frac{3}{7}x\\\\[/tex]

The slope of the equation is -3/7 and the y-intercept is 85/7

4 divided by what gives me the answer

Answers

Answer:

9

Step-by-step explanation:

inverse function of adding 12

Answers

Answer:

-12

Step-by-step explanation:

The graph shows a reflection.

True or false: The pre-image and the image are not congruent.

Answers

Answer:

False

Step-by-step explanation:

That is false

If the pre-image is reflected over any axis, the image will still be congruent to it

A tennis ball is tossed into the air. The height, h(t), in feet, of the tennis ball is a function of time, t, in seconds, as shown in the table below. What is the average rate of change of h on the interval 1 < t < 2.5?
0 0
0.5 20
1 32
1.5 36
2 32
2.5 20
3 0

Answers

The correct answer is 1.5 36

what is the solution to x + 9 = -18​

Answers

Answer: x= -27

Step-by-step explanation: subtract 9 from both sides to get x by itself

Answer:

X=-27 Should be the answer

Step-by-step explanation:

Subtract 9 from both sides of the equation

X = -18 - 9

Subtract 9 from -18

X = -27

860÷43 what is the answer?​

Answers

Answer:

20

Step-by-step explanation:

You would do this by dividing 43 into 860

The answer to the problem is 20

What single transformation was applied to triangle AAA to get triangle BBB?

Choose 1 answer:
Choose 1 answer:

(Choice A)
A
Translation

(Choice B)
B
Rotation

(Choice C)
C
Reflection

(Choice D)
D
Dilation

Answers

Answer:

the answer is D

Step-by-step explanation:

Answer:

answer

Step-by-step explanation:

answer is step 5 choice a

If correct ill give brainlist

Answers

Answer:

x=40

Step-by-step explanation:

Hi I don’t get it either welp

can someone help me find the area please?

Answers

Answer:

100 in ^2

Step-by-step explanation:

The area of a trapezoid is given by

A = 1/2 ( b1+ b2) *h  where b1 and b2 are the lengths of the bases and h is the height

A = 1/2 ( 16+9) * 8

   = 1/2 ( 25) *8

   = 100 in ^2

1/2*(l+L)*h
1/2*(9+16)*8=100

can someone help me on this plz

Answers

-4-4-4+9 = -3
so, they wound up with a loss of 3 yards
or, 3(-4)+9 = -3

for the sub, you want

-125 + 3(-50) = -125-150 = -275
Your setup yields -125(-150) = 18750 ft in the air!

220-4(35)
or, 220+4(-35)
Your final answer is correct, though, which shows that you not only don't know how to set up the expression, you do not know how to evaluate it once written!

You have an extra minus sign.

arwrerhrrwgewgewgrwqegwewes

Answers

I believe that the answer is A.

What is the common denominator?
3 4/9 and 2 5/6

Answers

18 is the common denominator

The tutor charges $40 plus $30 for each student in the group. Today the tutor has works with a group of students students and charges a total of $220.

Answers

So the tutor worked with a lot of students today then

PLEASE HELP FAST. EASY POINTS

Answers

To find the box to the top left, we can multiple the sides like rectangles. To find the top left box, we can multiply -1 and 0.5y to get -0.5y.

To find the box on the bottom right, we can multiply the sides like rectangles again. To find the bottom right box, we can multiply 24x and 3 to get 72x.

1. You make a compound word, such as houseboat, by joining two words together. Why do you think -4 < x < 7 is called a compound inequality?
2. The intersection of two roads is the place where the roads cross. How would you define the intersection of two groups of objects?

Answers

Answer:

because it has two parts

Step-by-step explanation:

thats what the first one is

X(3, 4); scale factor = 7

Answers

Answer:

(21, 28)

Step-by-step explanation:

Multiply coordinates by 7.

(21,28)

Your welcome can I get a thanks

what is 5/8x + 1/5x = 99

Answers

x = 120

Too long to exaplin.

Just trust me

Hope this helps I attached a photo with answer and steps

Jimmy has collected 100 aluminum cans to recycle. He plans to
collect an additional 25 cans each week. Write an equation for the total
number of cans, c, after w weeks. If jimmy collected cans for 5 weeks, how
many cans did he collect?
Equation:
Answer:

Answers

Answer:

Jimmy recicled a total 125 cans in 5 weeks.

Step-by-step explanation:

25✖️5= 125

-Have a nice day!

Which of the following best describes the blue line in the image below

Answers

C i believe it will Be!

Answer:

C the line through point C that is perpendicular to the segment AB

write each fraction in simplest form

Answers

your answer would be 1/3

Answer:

1/3 or -1/3

Step-by-step explanation:

3. You sell storm windows and doors. You receive a straight

commission of 8% of the selling price of each storm window

and 12% of the selling price of each door. What total

commission will you receive for selling $5,400 in storm

windows and $28,790 in doors?

Answers

Answer:

[tex]\$3886.8[/tex]

Step-by-step explanation:

Commission received on selling each storm window [tex]=8\%[/tex] of the selling price of each storm window

Commission received on selling each door [tex]=12\%[/tex] of the selling price of each door

Amount earned on selling storm windows = $5,400

Amount earned on selling doors = $28,790

Commission received on selling storm windows [tex]=\frac{8}{100}(5,400)=\$432[/tex]

Commission received on selling doors [tex]=\frac{12}{100}(28,790)=\$3454.8[/tex]

Therefore,

Total  commission received [tex]=432+3454.8=\$3886.8[/tex]

g(x) = -3x + 1

solve for x (which is 22)

Answers

Answer:

-65

Step-by-step explanation:

Answer:

-65

Step-by-step explanation:

-3(22) + 1

-65

PLEASE I REALLY NEED HELP

Answers

Answer:

80 students

Step-by-step explanation:

The line in the middle of the box is the 50% line ( the median, which is 50% above and 50% below)

Since it is at 48, there are 50% above 48 points

3/4 of the students  had less than 70 marks

3/4 s = 120

s = 4/3 * 120

The number of students = 160

We need 50 % of the students

50% of 160

.5 * 160 = 80

Other Questions
What is mass? In matter and energy A student records a physical property of a rock as 2.2N. Which physical property has the student measured? What does Beowulf foresee concerning Freawarus marriage Carbon decays every 5700 years. If you found a rock containing Carbon that has gone through 2.5 half lives, how old is that rock? Love after Love By Derek Walcott What are machines fueled by?1. Energy 2. Electricity only3. gasoline only4. Sun You measure containers for international shipments. The height of the standard container is 6 feet and 7 inches. What is the height in meters? TIME REMAINING52:45The robotic rover Curiosity has instruments that detect radiation both inside the spacecraft and in the Mars environment. What is most likely the purpose of this radiation detection?to determine whether human exploration of Mars is possibleto develop better X-ray technologyto find evidence of once-living Martian microorganismsto investigate evidence of hydrogen and water (1/3)^2=? I need help with math I'm failing, because of my teacher By finding out who Figaro's parents are how does this inconvenience the Count? Starting from rest, a car travels 18 meters as it accelerates uniformly for 3.0 seconds. What is the magnitude of the car's acceleration? A. 6.0 m/s2 B. 2.0 m/s2 C. 3.0 m/s2 D. 4.0 m/s2 78There are 32 desks in a room.If x represents the number of rows of desks, which expression would equal the number of desks in each row?0 32 + x32 - xO 320 3/x Rafael can type 24 words in 6 minutes. What is his rate in words per minute what happen when two light waves traveling from oppsite direactions meet? if a doctor states that a patient has a bone break in the left anterior portion of their body, lateral to midline in their thoracic cavity, what can you assume im broken? In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services. 275,000 plus 5.4 times 10 to the 5th power