Simplify the equation (-2w) to the fifth power.

(FYI: I typed to the fifth power because I couldn't figure out how to type powers)

Answers

Answer 1

The value of the given expression is -32w⁵.

What is simplify?

Simplify simply means to make it simple. In mathematics, simply or simplification is reducing the expression/fraction/problem in a simpler form. It makes the problem easy with calculations and solving.

The given expression is (-2w)⁵.

Here, (-2w)⁵=(-2)⁵×w⁵

= -32w⁵

Therefore, the value of the given expression is -32w⁵.

Learn more about the simplification here:

brainly.com/question/2804192.

#SPJ1


Related Questions

Work out the surface area of this solid prism,
25cm
29cm
20cm
40cm
36cm

Answers

Answer:

The figure isn't there brother

Jason has some money. His grandmother gives him another $18.00. Write an expression to show how much money Jason has now. Use x for your variable.

Answers

Answer:

x + 18

Step-by-step explanation:

The variable is going to be the amount of money Jason has before his grandmother gives him money.

That variable is x.

Then, his grandmother gives him $18. The $18 would be added to the amount of money that Jason already has.

The expressions would be x + 18.

What’s the equation y= what ? pls help me!

Answers

Answer:

Y=mx+b

Step-by-step explanation:

That's the slope equation, though y could mean anything from a point on a graph to the question.

victoria took a test and got 80% of the questions right. she answered 20 questions correctly. how mnay queestions were on the test

Answers

Answer:

25

Step-by-step explanation:

let there be x questions on the test

80% of x = 20

80% * x = 20

80% = 0.8

0.8 * x = 20

divide both sides by 0.8 to isolate x

x = 20/0.8 = 25

Someone help plz make sure it’s right plz will mark brainiest if it is:)

Answers

The 4th one is correct

Answer:

4th picture is the correct one :)

Find the area of the shaded sector.

85.64 m2
64.25 m²
7.75 m²
92.99 m²

Answers

Answer:

look at the picture I sent

ILL MARK YOU BRAINLEST IF YOU AWNSER PLEASE!! look at the photo and what is the measure of BMC?help me please!!

Answers

2x + (x+9) = 90
3x + 9= 90
3x= 81
x= 27
Now plug in 27 to (x+9)
27+9= 36
Final Answer = 36

Find the perimeter of the figure to the nearest hundredth

Answers

Answer:

perimeter of parallelogram 2 (a+b)

2 (7+5)

24

perimeter of semicircle=1\2 pi D

1/2 22/7 × 5

get your answer

add the 24 and the answer you get

if decimal move three decimal to right and that is the answe

can someone help with this please

Answers

9514 1404 393

Answer:

  -2

Step-by-step explanation:

When you're looking for f(3), you want the y-value that corresponds to the x-value of 3. Find it by locating 3 on the x-axis. Then follow the vertical grid line to the point where the function value is shown. From there, identify the y-coordinate of that point. That y-coordinate is f(3).

  f(3) = -2

__

The open dots at the ends of the curves at x=3 mean the function is not defined at those points: (3, 1) or (3, -9). The solid dot at (3, -2) tells you the function value at x=3 is -2.

Help me how do you do this plz no links

Answers

It is x=12 or the last option

Answer:

12

Step-by-step explanation:

According to the Pythagorean Theorem,

5^2 + X^2 = 13^2, OR

25 + X^2 = 169

X^2 = 169, SO X = √144, or 12

The unknown side has length 12.

Help please!!!!!!!!!

Answers

Answer:

a=8

b=⅛

c= 2.6

d= 0.26

that's all the answers

a) 4x=32, x=8
b)4=32x, x=4/32 or 1/8
c)10x=26, x= 26/10 or 13/5
d)26=100x, x=26/100 or 13/50

The following is a stem-and-leaf display representing the amount of gasoline purchased, in gallons (with leaves in tenths of gallons), for a sample of 25 cars that use a particular service station on the New Jersey Turnpike: 9 147 10 02238 11 125566777 12 223489 13 02 (a) Construct an ordered array. (b) Which of these two displays seems to provide more information? Discuss

Answers

The ordered array will be 9.1 9.4 9.7 10.0 10.2 10.2 10.3 10.8 11.1 11.2 11.5 11.5 11.6 11.6 11.7 11.7 12.2 12.2 12.3 12.4 12.8 12.9 13.0 13.2

What is leaf plot?

A stem and leaf plot, also known as a stem and leaf diagram, is a way to arrange data so that it is simple to see how frequently various sorts of values occur. It is a graph that displays ordered numerical data. A stem and a leaf are divided into each piece of data.

In this instance, the number on the left of the division stands in for the number in the tens place. The value or values on the right side are the ones that fall between the tens and ones places. The number "9.1" is the equivalent of the word "911," for instance. When a number appears more than once on the right side of a division, that number appears more than once in the tens place. In this case, the three numbers 9.1, 9.4, and 9.7 are represented by the string "9 | 147".

Hence, There is an ordered array when reading the stem and leaf plot from top to bottom:

9.1 9.4 9.7 10.0 10.2 10.2 10.3 10.8 11.1 11.2 11.5 11.5 11.6 11.6 11.7 11.7 12.2 12.2 12.3 12.4 12.8 12.9 13.0 13.2

Learn more about leaf plot, by the following link

https://brainly.com/question/8649311

#SPJ4

what is 6x²+7x-20? im having trouble trying to figure it out.

Answers

Answer: (2x+5)x(3x-4)

Someone please help me with this

Answers

Dont go to the link!!

What is the difference between log 10 and log e?

Answers

The difference between log with base 10 and log with base e is that the log with base 10 is called a common logarithmic function and the log with base e is called a Natural Logarithmic Function .

What is Logarithmic Function ?

The logarithm is defined as a power to which a number must be raised in order to get some other values. Log is the most convenient way to express the large numbers.

The Logarithm with base 10 is defined as a power to which the  number must be raised  to get some other number. It can also be  called as the logarithm of base 10, or common logarithm.

The general form of Common  logarithm is written as: [tex]log_{10} (x)[/tex] ;

The Logarithm  with base e is called as Natural Log , where e is an irrational number .

The general form to represent a Natural Log is : [tex]log_{e} (x)[/tex] or [tex]ln(x)[/tex] .

Learn more about Logarithm here

https://brainly.com/question/11630468

#SPJ4

Base your answer(s) to the following question(s) on the diagram of a food web and on your knowledge of biology. If the population of mice is reduced by disease, which change will most likely occur in the food web? A. The cricket population will increase. B. The snake population will increase. C. The grasses will decrease. D. The deer population will decrease.

Answers

The cricket population will increase

What is your walking rate in yards per minute?

Answers

If you walk at a constant speed of x (I will let you determine x) x=step length you will the determine your time per yard... then multiply it by however you get it to 60.
Answer: Conversion number between yards per minute [ypm] and walking speed is 0.010885714285714. This means, that yards per minute is a smaller unit than walking speed.

A photographer takes 12 different photographs. There are 3 sunsets, 4 oceans, and 5 mountains.

How many possible arrangements are there if all the photographs of the mountains are next to each other?

Answers

Answer:

4838400 arrangements

--------------------------------------------------

Permutation of 5 mountain photographs:

P(5, 5) = 5! = 120

Since all are next to each other, the mountain photographs count as one item along with the other 3 + 4 = 7 photographs and therefore the permutation for this is:

P(8,8) = 8! = 40320

Total arrangements is:

120*40320 = 4838400


The domain of f(x)=ln(x) is negative infinity, infinity.

False, because a logarithmic function is defunded only for positive real numbers

False, because a logarithmic function is defined only for non-negative real numbers

False, because a logarithmic function is defined only for negative real numbers

Answers

Answer: Choice A

False, because a logarithmic function is defined only for positive real numbers.

===========================================================

Explanation:

Using your calculator, you should see that ln(0) is undefined or it leads to some kind of error. The same happens when you try ln(-1) or any other negative number. So ln(x) only allows x > 0. This applies to any log function, and not just the natural log function.

This is why choice A is the answer. Choice B is close, but the use of "non-negative" is not correct because that means 0 is involved. But as explained above, 0 is not allowed as part of the domain.

-----------------

Extra info (optional section)

As for why 0 and negative numbers are not allowed, you have to look carefully at what logs are designed for. They were formed to help solve exponential equations. Consider the following equation

2^x = 16

We could do guess and check to see which value would replace x. You should find that x = 4 is the solution. Though another way to solve is to use logs. The given equation converts to the log form of [tex]x = \log_2(16)[/tex]; note how the number inside the parenthesis is positive. We can't have 2^x equal to a negative value, due to powers of a positive number being a positive result. So that's why we rule out negative numbers as part of the domain. Zero is excluded for similar reasoning.

Answer:

negative infinity

positive infinity

Step-by-step explanation:

edg 2022

Veronica bought a house with an FHA loan. She pays $780 a year for real estate taxes
and $900 a year for homeowner's insurance. What is the monthly amount added to
Veronica's mortgage payment?
A: $140
B: $65
C: Not enough information given to compute impound amount
D: $1,680

Answers

900/12= 75
780/12= 65
75+65=140
The answer is a
The answer would be A ($140)

Which equation best models relationship between the height X and circumference why of the young trees
NO LINKS !!

Answers

Answer:

i think it’s B

Step-by-step explanation:

The scale factor of the blueprint of a gymnasium to the actual gymnasium is 1 in15 ft . The area of the floor on the blueprint is 114 in2 . What is the area of the actual gymnasium

Answers

The area of the actual gymnasium is 25,650 square feet.

We know that the scale factor of the blueprint to the actual gymnasium is 1 in 15 ft, which means that every 1 inch on the blueprint represents 15 feet in the actual gymnasium. To find the area of the actual gymnasium, we can use the formula:

Area of actual = (Area of blueprint) x (Scale factor)²

We know that the area of the floor on the blueprint is 114 square inches, so we can plug that into the formula:

Area of actual = 114 in² x (15 ft/1 in)² = 114 in² x 225 ft² = 25,650 ft²

Therefore, the area of the actual gymnasium is 25,650 square feet.

To learn more about the area, visit:

brainly.com/question/16151549

#SPJ4

Find the length of the third side. If necessary, round to the nearest tenth

Answers

On solving the provided question, we can say that it is right angle triangle provided, so  cos 60 = 3/H => 1/2 = 3/H => H = 6

What is triangle?

A triangle is a polygon since it has three sides and three vertices. It is one of the basic geometric shapes. The name given to a triangle containing the vertices A, B, and C is Triangle ABC. A unique plane and triangle in Euclidean geometry are discovered when the three points are not collinear. Three sides and three corners define a triangle as a polygon. The triangle's corners are defined as the locations where the three sides converge. 180 degrees is the result of multiplying three triangle angles.

it is right angle triangle provided,

so

cos 60 = 3/H

1/2 = 3/H

H = 6

To know more about triangle visit:

https://brainly.com/question/2773823

#SPJ1

HELP PLEASE ANSWER THIS QUESTION!!!

Answers

Answer:

First use the formula of diamete which is d by 2

Step-by-step explanation:

which the answer comes 6 and after that use formula of area of a semcicle that is pie into radius square and the answer comes 113.14

What is the solution?

Answers

Answer:

no solution

Step-by-step explanation:

The lines do not cross at any point; therefore, there is no solution.

Graph the line that passes through the points (9, 4) and (9, 1) and
determine the equation of the line.

Answers

Answer:

x = 9

Step-by-step explanation:

The equation is y = mx + b

m = The slope

b = y-intercept

The slope here is undefined, and there is no y-intercept, so the equation is

x = 9

QUICK PLEASE IM COuNTING ON YOU!!!!!!! If you were to connect three light bulbs in parallel and then connect three light bulbs in series, from which circuit will the light bulbs be brighter?

Answers

Answer:

SeeStep by Step explanation

Step-by-step explanation:

Currently, light bulbs need nominal voltage in their operation ( that is if your system is 120 V  phase-neutral ) they will have a nominal voltage 120 (v). For that reason, all of them need this voltage for their proper operation, which follows that in any circuit the bulbs must be installed in parallel.

If you install them in series, the first will get most of the 120 (v) let´s say  90 (V), and  maybe work, but the next one won´t work because the voltage will drop and between the terminals of the second bulbs you surely measure 20 (V) or less, the third one will be working with 10 (V) according to kirchhoff´s second  law

John is 14 years older than Sam and the product of their ages is 207. How old is Sam? A. 11 B. 9 C. 23 D. 8

Answers

Answer:

The answer is A!

Step-by-step explanation:

Answer:

207 divided by 14 = 14 remainder 11 so.. none of the answers are right

14x11=154

14x9=126

14x23=322

14x8=112

Step-by-step explanation:

the graph of h(x)=-x^2+4x+4​

Answers

Answer:

Step-by-step explanation:

the coefficients of this quadratic are -1, 4 and 4, and so the discriminant b^2 - 4ac works out to 16 - 4(-1)(4), or 0.  Thus this graph has two real, equal roots which are the same point on the graph, the vertex, the maximum of the function.

Letting x = 0, we find that y is 4.  Thus, the y-intercept is (0, 4).  Plot this.

Using the formula x = -b / [2a], we find the axis of symmetry:

   x = -4 / [2*(-1)] = -4 / [-2] = +2

The axis of symmetry is the vertical line x = 2.  

At x = 2, y = -(2)^2 + 4(2) + 4, OR -4 + 8 + 4, or 0.

The vertex and maximum value are (2, 0).  The graph touches the x-axis in only one place.

Draw the axis of symmetry x = 2.  Plot the vertex (2, 0) and the y-intercept.  Reflect the y-intercept about the axis of symmetry to obtain a second point on the graph at the same y-value as (0, 4).

How do you find the nature of the roots of a given quadratic equation?

Answers

To find the nature of the roots of a given quadratic equation, use the quadratic formula, which is [tex]x= \frac{(-b±\sqrt{b^2-4ac} )}{2a}[/tex].

Finding the Nature of Roots of a Quadratic Equation

Substitute the values of a, b, and c from the given equation into the formula and solve for x. The nature of the roots can then be determined by examining the sign of the discriminant, b² - 4ac.

If the discriminant is positive, the quadratic equation will have two real roots; if the discriminant is zero, the quadratic equation will have one real root; and if the discriminant is negative, the quadratic equation will have two complex roots.

Learn more about quadratic equation: https://brainly.com/question/1214333

#SPJ4

Other Questions
The wind force f on a sail varies jointly as the area a of the sail and the square of the wind speed w. The force on a sail with an area of 500 ft^2 is 64. 8 pounds when the wind speed is 18 mph. What would be the force for a sail with an area of 250 ft^2 with a wind speed of 35 mph Are Tropical rain forests are typically located close to the equator? plane flew from Red Deer to Winnipeg, a flying distance of 1260 km. On the return journey, due to a strong head wind, the plane travelled 1200 km in the same time it took to complete the outward journey. On the outward journey, the plane was able to maintain an average speed 20 km/hr greater than on the return journey. Calculate the average speed of the plane from Winnipeg to Red Deer. To pay for a $15,900 car, Donna made a down payment of $4800 and took out a loan for the rest. On the loan, she paid monthly payments of $245.70 for 4years.(a) What was the total amount Donna ended up paying for the car (includingthe down payment and monthly payments)?(b) How much interest did Donna pay on the loan? Is this correct? I can't figure out if this is, So please answer. streamlined transportation vehicle with 2 openings and glass windows. It appears to run on some kind of track.Predict what the text will be about based on this image?a.future transportationc.both of theseb.public transportationd.neither of these Sam has always been able to pick up new languages easily. What quality does she have that helps her do this?soft skills.self-awarenesscompetencyability What baseball stat does Lawrence Hinman suggest is the most important stat for determining the best player in the game in a given year Where should the comma go in the following sentence **You should not need to round on this problem, no %'s decimals only**At Houston Community College 60% of the students who take English will pass. Of those who pass English, 70% will also pass Accounting. Of those that do not pass English, 45% will still pass accounting. How do you find the 3rd side of a triangle? Select the correct answer. Which graph represents the solutions to this equation? x2 + 8x = -20 A. Linear-quadratic system graph shows upward parabola with vertex at (minus 2, 4) and passing through x and y-axis (minus 8, 0), and (0, 0) B. Linear-quadratic system graph shows upward parabola with vertex at (minus 4, 4) and passing through (minus 2, 8), and (minus 6, 8) C. Linear-quadratic system graph shows upward parabola with vertex at (4, 0) and passing through (1, 4), and (6, 4) D. Linear-quadratic system graph shows a downward parabola with vertex at (0, 8) which intercepts the x-axis at 3 and minus 3 units. Lila swam 50 meters north in 10 seconds. Find Lila's velocity TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets. True/False: Money is more important than finding something you're going to lovedoing. Select the correct answer.Which of these is an example of elemental carbon?A. DiamondB. MethaneC. Proteins 6 less than 3 times a number 42 what is the number Two numbers total 31 and have a difference of 9. Find the two numbers. Can someone help me with this question? Can someone please help me with math.