Protein, B vitamins, and iron all play important roles in supporting the immune system.
Protein is essential for the production of antibodies and immune cells that help to fight off infections. It is also needed for the repair and maintenance of tissues that have been damaged by infections.
B vitamins, particularly vitamins B6, B9 (folate), and B12, are involved in the production of immune cells and antibodies. These vitamins also help to regulate immune cell function and promote the production of cytokines, which are important signaling molecules that help to coordinate the immune response.
Iron is necessary for the production of hemoglobin, which is a protein in red blood cells that carries oxygen to the body's tissues. Iron is also involved in the function of immune cells and the production of cytokines. However, too much iron can actually be harmful to the immune system, as it can promote the growth of harmful bacteria and viruses.
To learn more about antibodies refer to:
brainly.com/question/27931383
#SPJ4
all are characteristics of erythrocytes except: group of answer choices makes up large percentage of total blood cells lacking a nucleus or mitochondria involved with carrying oxygen to body cells high surface area to volume ratio due to biconcave disk shape integral to inflammatory and immune responses
All are characteristics of erythrocytes except: integral to inflammatory and immune responses. The correct option is e.
Erythrocytes, also known as red blood cells, are one of the three types of blood cells that are found in the human body. These blood cells are the most numerous of all the blood cells, comprising about 40-45% of the total volume of blood, and they are unique in shape, structure, and function.
The erythrocytes are characterized by the following:
Group of answer choices that makes up a large percentage of total blood cells
Lacking a nucleus or mitochondria
Involved with carrying oxygen to body cells
High surface area to volume ratio due to biconcave disk shape
Integral to inflammatory and immune responses
The fifth option given in the question, integral to inflammatory and immune responses, is not a characteristic of erythrocytes. This is because erythrocytes do not have any role in the inflammatory and immune responses, as they lack the organelles necessary for carrying out these processes. Instead, these responses are carried out by other types of blood cells, such as leukocytes or white blood cells, which are specialized in this function.
Therefore, the correct answer to this question would be option E, "integral to inflammatory and immune responses."
Here you can learn more about Erythrocytes
https://brainly.com/question/16794540#
#SPJ11
what was the most significant conclusion that gregor mendel drew from his experiments with plants quilzet biology chapater 14
The most significant conclusion that Gregor Mendel drew from his experiments with plants was that heredity is determined by discrete units called genes.
Genetics is the scientific discipline that examines how characteristics are passed from one generation to the next. It also analyses the mechanisms underlying these processes. Gregor Mendel, an Augustinian monk, established the groundwork for genetics with his work on pea plants, which he published in 1866.
Mendel's key conclusion was that heredity is determined by discrete units called genes, which occur in pairs. These genes are passed from one generation to the next in a predictable manner, obeying the principles of probability. In addition, Mendel discovered that these genes may be dominant or recessive in their expression.
According to Mendel's model, these genes combine in a predictable manner during reproduction, with each parent contributing one of two possible versions of a gene to their offspring. This interaction creates the genetic diversity seen within and between populations.
Learn more about genetics here:
https://brainly.com/question/30459739
#SPJ11
Think about the long sections of peeled celery. Did you see what you thought you would see? Based on what you observed, what can you conclude about the movement of water through the celery stalk? Explain your reasoning. (8 points)
Since it has many xylem tubes in the stalk and so quickly absorbs water, celery is a useful plant for illustrating capillary action. The light green foliage will change to a reddish and blue hue.
How does water flow within a celery stalk?Permeability motion be demonstrated by flow of water through celery. Both plants and people depend on capillary movement. Water travels upward from the plant's root system through stems to the leaves and branching. The nutrients and minerals that the plant requires for growth are present in the water that travels through the stem.
What was the celery experiment's outcome?The experiment also with celery stick indicates that this occurs using specialized tubes, known as xylems, which absorb the food colouring. Celery leaves' poration speeds up the process, and you may speed it up even more by blow drying the leaves.
To know more about capillary visit:
https://brainly.com/question/15471683
#SPJ1
true/false: the primary advantages induced enzymes bestow on the cell are energy and resource conservation.
It is TRUE that the primary advantages induced enzymes bestow on the cell are energy and resource conservation.
Induced enzymes are enzymes that are synthesized by the cell in response to a specific substrate or environmental condition. The primary advantage of induced enzymes is that they allow the cell to conserve energy and resources by only producing the enzymes when they are needed. Induced enzymes help the cell to regulate its metabolism and respond to changes in its environment in a flexible and efficient way. By producing enzymes only when they are needed, the cell can avoid wasting energy and resources on unnecessary metabolic pathways. Therefore, the statement that the primary advantages induced enzymes bestow on the cell are energy and resource conservation is true.
To know more about induced enzymes
brainly.com/question/30354727
#SPJ4
describe the different arrangements of genetic info in prokaryotic and eukaryotic cells: chromosome loop, chromatin, linear chromosomes
In prokaryotic and eukaryotic cells, genetic information is organized differently due to their distinct structures. In prokaryotes, genetic information is present in loop.
What is the genetic arrangement in prokaryotes and eukaryotes?In prokaryotic cells: 1. Chromosome loop: Prokaryotic cells, such as bacteria, typically have a single, circular chromosome in the form of a loop. This loop is called the bacterial chromosome and contains all the genetic information required for the cell's functioning.
In eukaryotic cells: 1. Chromatin: Eukaryotic cells have a more complex organization of genetic material. The DNA is packaged with proteins called histones, forming a complex called chromatin. Chromatin is further organized into structures called nucleosomes. 2. Linear chromosomes: Unlike prokaryotic cells, eukaryotic cells contain multiple, linear chromosomes.
These chromosomes are housed within the cell nucleus, providing an additional layer of organization and protection for the genetic material. In summary, prokaryotic cells have a single chromosome loop, while eukaryotic cells have chromatin and multiple linear chromosomes.
Learn more about Genetic information here:
https://brainly.com/question/6748577
#SPJ11
what was esther lederberg was able to demonstrate with her replica plating experiments wileyplus
Lederberg's replica plating experiments provided important evidence for the existence of spontaneous mutations in bacteria, and helped to lay the foundation for the field of bacterial genetics.
Esther Lederberg was able to demonstrate the presence of spontaneous mutations in bacteria using her replica plating experiments. In her experiments, Lederberg took a bacterial culture and made several copies of it on different agar plates.
She then exposed each plate to a different condition, such as an antibiotic, to see if any bacteria would grow under that condition. She found that some bacteria would grow on certain plates but not on others, suggesting that they had acquired a resistance to the specific condition being tested.
Lederberg then used replica plating to transfer bacteria from the original plate to a new plate without exposing them to any conditions, and found that some of the bacteria still grew on the plates that they previously could not. This indicated that some bacteria had spontaneously acquired mutations that allowed them to survive under the new conditions.
To know more about replica plating here
https://brainly.com/question/27334956
#SPJ4
in the cell line that entered mitosis, why do you think there was a delay before the onset of mitosis after exposure to gamma radiation?
When a cell line enters mitosis, the delay before the onset of mitosis is because of the cell cycle checkpoint.
What is the effect of gamma radiation on cell line?
Gamma radiation is known to induce double-stranded breaks in the DNA of cells that can lead to cell death. When cells are exposed to gamma radiation, the DNA damage in the cell can cause a delay before the onset of mitosis.
During this delay, the cell activates the DNA damage checkpoint to check for any damage in the DNA of the cell. This checkpoint delay allows time for the cell to repair any damage in the DNA before proceeding into mitosis.
In summary, the delay before the onset of mitosis in the cell line that entered mitosis after exposure to gamma radiation was due to the cell cycle checkpoint.
Read more about Gamma radiation here:
https://brainly.com/question/1686231
#SPJ11
What is the type of mutation that shifts the reading frame of the genetic message by inserting or deleting a nucleotide?
The type of mutation that shifts the reading frame of the genetic message by inserting or deleting a nucleotide is called a frameshift mutation.
Frameshift mutations are a type of genetic variation that can occur during DNA replication or repair, and they involve the addition or deletion of one or more nucleotides from a DNA sequence that is not divisible by three.
Frameshift mutations can have significant effects on an organism, as they alter the reading frame of the genetic code downstream of the mutation site, leading to a different amino acid sequence and potentially a non-functional protein. Frameshift mutations can also cause premature termination of protein synthesis if they introduce a premature stop codon.
Frameshift mutations can be caused by mutagens such as certain chemicals, radiation, or errors during DNA replication. They can also occur naturally as a result of genetic recombination or replication errors.
To learn more about frameshift mutation
https://brainly.com/question/14364090
#SPJ4
one surprising aspect of the immune system is that individuals make responses against human tissues from different individuals, causing serious problems for organ and tissue transplantation. the basis for this immune response is:
The basis for this immune response is the major histocompatibility complex (MHC) in the immune system.
What is the major histocompatibility complex?The major histocompatibility complex (MHC) is a gene complex that encodes cell surface molecules that are necessary for the acquired immune system to identify foreign antigens, usually proteins from invading microorganisms, and to distinguish them from self-antigens. This complex also plays a critical role in histocompatibility, or the compatibility of tissues and organs transplanted from one individual to another. Because MHC genes are highly polymorphic, meaning they vary greatly between individuals, they can be used to differentiate individuals and populations.
In humans, the major histocompatibility complex is also known as the human leukocyte antigen (HLA) system. There are three types of MHC genes, with classes I, II, and III. Classes I and II are critical for immune responses, while class III genes are involved in immune system regulation and other functions. MHC class I molecules are expressed on the surface of almost all nucleated cells and present peptides derived from intracellular proteins, while MHC class II molecules are found mainly on professional antigen-presenting cells such as dendritic cells, macrophages, and B cells, and present peptides derived from extracellular proteins.
Therefore, the immune system response against human tissues from different individuals is because of the major histocompatibility complex (MHC) in the immune system.
Here you can learn more about major histocompatibility complex (MHC)
https://brainly.com/question/29525257#
#SPJ11
synovial joints are considered very weak joints because of the great range of motion they allow. which of the following structures helps to stabilize a synovial joint?synovial joints are considered very weak joints because of the great range of motion they allow. which of the following structures helps to stabilize a synovial joint?synovial fluidarticular cartilageligamentsfibrous capsule
Synovial joints are considered very weak joints because of the great range of motion they allow ligaments.
While synovial joints do allow for a wide range of motion, they can be stabilized by ligaments, which are strong bands of connective tissue that connect bones to each other and help to limit excessive movement at the joint. The fibrous capsule also helps to stabilize the joint by enclosing the joint and providing additional support, while the synovial fluid lubricates the joint and helps to reduce friction during movement. The articular cartilage covers the surfaces of the bones where they meet at the joint, providing a smooth surface for the bones to glide against each other.
To know more about Synovial joints
brainly.com/question/5847359
#SPJ4
Why do you feel scientists classify animals?
Answer: It is necessary to classify animals for their easy identification, their study and research
Explanation:
Answer:
scientists group organisms into groups to nake it easy to study them. It is also done to help people understand the topic more easily
Explanation:
1. Explain the difference between
transcription and translation in DNA.
Make sure you are able to take a DNA
segment and transcribe it and
translate it into mRNA and proteins.
Transcription is the process by which an RNA molecule is produced from one of the DNA strands whereas translation, on the other hand, is the process by which the mRNA molecule is used to synthesize a specific protein.
What is the difference between transcription and translation in DNA?Transcription is the process by which RNA polymerase enzyme reads the DNA sequence and synthesizes an RNA molecule that is complementary to one of the DNA strands.
During transcription, the DNA double helix is unwound, and the RNA polymerase enzyme adds nucleotides to the growing RNA molecule following the base-pairing rules of A-U and G-C. The resulting RNA molecule is called messenger RNA (mRNA), and it carries the genetic information from DNA to the site of protein synthesis.
Translation, on the other hand, is the process by which the mRNA molecule is used to synthesize a specific protein. Translation occurs in the ribosome, where transfer RNA (tRNA) molecules with attached amino acids bind to the mRNA codons in a complementary fashion. This process results in the formation of a polypeptide chain that folds into a functional protein.
To demonstrate these processes, let's take the following DNA segment as an example:
DNA sequence: TACAGCGACGCGTATCGAGG
Transcription:
The first step in transcription is to identify the DNA strand that will serve as the template for the RNA synthesis. In this case, we will use the template strand (the complementary strand to the coding strand).
Template DNA strand: ATGTCGCTGCGCATACTCC
The RNA polymerase enzyme will read this template strand and synthesize a complementary RNA molecule by adding nucleotides to the growing chain. The resulting mRNA molecule will have the same sequence as the coding strand (except for U instead of T).
mRNA sequence: AUGUCGCUGCGCAUACUCCG
Translation:
The mRNA sequence can now be translated into a protein sequence using the genetic code, which is a set of rules that determine how the nucleotide sequence of an mRNA molecule is translated into the amino acid sequence of a protein.
AUG-UCG-CUG-CGC-AUA-CUC-CG
Using the genetic code table, we can determine the amino acid sequence of the protein:
AUG: Methionine
UCG: Serine
CUG: Leucine
CGC: Arginine
AUA: Isoleucine
CUC: Leucine
The resulting protein sequence is: Met-Ser-Leu-Arg-Ile-Leu.
Learn more about transcription and translation at: https://brainly.com/question/11214205
#SPJ1
What transfers DNA to the ribosome?
Answer: mRNA
Explanation: Messenger RNA
what types of gene mutations can result in proteins that are larger (longer polypeptide chains) than the protein produced by the normal allele? (check all that apply.)
The types of gene mutations can result in proteins that are larger (longer polypeptide chains) than the protein produced by the normal allele are:
A) frameshift mutationB) silent mutationC) missense mutationF) addition of 2 ntG) addition of 1 ntFrameshift mutations occur when nucleotides are added or deleted from a DNA sequence, causing a shift in the reading frame during translation. This results in a completely different amino acid sequence from the original, often resulting in premature termination or an elongated protein.
Addition of 2 nt or 1 nt can also cause a frameshift mutation, leading to a longer protein. These mutations occur when one or two nucleotides are added to the DNA sequence, shifting the reading frame during translation.
Silent mutations, missense mutations, substitution mutations, deletion of 2 nt, deletion of 1 nt, and splice site mutations do not necessarily result in a larger protein, as they typically involve changes to individual nucleotides or small sections of the DNA sequence.
To learn more about mutations, here
https://brainly.com/question/30696458
#SPJ4
The complete question is:
What types of gene mutations can result in proteins that are larger (longer polypeptide chains) than the protein produced by the normal allele? (check all that apply.)
A) frameshift mutationB) silent mutationC) missense mutationD) substitution mutationE) deletion of 2 ntF) addition of 2 ntG) addition of 1 ntH) deletion of 1 ntI) splice site mutationsAnimal cells have a cell membrane.
The cell membrane protects the cell from its surroundings.
Combine the sentences into one sentence.
The cell membrane, also called the plasma membrane, is found in all cells and separates the interior of the cell from the outside environment. The cell membrane consists of a lipid bilayer that is semipermeable. The cell membrane regulates the transport of materials entering and exiting the cell.
you count 42 yeast cells in one 'foursquare' volume on your hemocytometer. what is the concentration of cells in that sample? g
The concentration of cells in that sample is [tex]1.05[/tex]× [tex]10^6[/tex] cells/mL.
We are given that, The number of yeast cells = 42
Volume of hemocytometer = Foursquare volume.
Now, The concentration of cells in the sample is the number of cells divided by the volume. We'll use the following formula:
Concentration = Number of cells / Volume
In this case, the volume is in a foursquare. The volume of a hemocytometer square is usually 1/25 of the whole surface area of the hemocytometer.
We know that the area of the hemocytometer is 9 mm × 9 mm or 81 mm².
Therefore, the area of each square is 1/25th of 81 mm², or 3.24 mm².
The volume of each square is equal to the depth of the chamber, which is usually 0.1 mm, multiplied by the area. This equals 0.324 cubic mm.
1 cubic mm = 1/1000 mL = 1/1000 × [tex]10^-^6[/tex] L = [tex]10^-^9[/tex] L
So, the volume of the square is 0.324 × [tex]10^-^9[/tex] L
The concentration can now be calculated as follows:
Concentration = Number of cells / Volume
= 42 cells / 0.324 × [tex]10^-^9[/tex] L
= 42 / 0.324 x [tex]10^-^9[/tex]cells/mL
= 1.05 x[tex]10^6[/tex] cells/mL.
Therefore, the concentration of yeast cells in the given sample is 1.05 ×[tex]10^6[/tex] Cells/mL.
To know more about Cells refer here :
https://brainly.com/question/13920046
#SPJ11
true or false? according to bill gates's talk, covid-19 could be the last pandemic if we take the right steps?
It is FALSE that according to Bill Gates's talk, COVID-19 could be the last pandemic if we take the right steps.
While Bill Gates has talked about the importance of taking steps to prevent future pandemics, he has not made a definitive statement that COVID-19 could be the last pandemic. In fact, he has emphasized that the world needs to be prepared for the possibility of future pandemics, as viruses can emerge unexpectedly and rapidly spread across the globe. Gates has advocated for investing in disease surveillance and research, developing vaccines and therapeutics, and improving global cooperation to better respond to future outbreaks.
To know more about COVID-19
brainly.com/question/30975256
#SPJ4
g he estrous cycle has 4 phases. the first phase is called estrous . during this phase the stimulates the developments of follicles and the follicular cells secrete . this hormone stimulates the production of and the thickening of the endometrium. when reaches a peak, and ovum is released. this phase is called
The hormone stimulates the production of cervical mucus and the thickening of the endometrium. When estrogen reaches a peak, an ovum is released in a process called ovulation. This phase is called estrus.
Most mammalian species, including domestic animals like cows, pigs, and horses as well as some wild species, have an estrous cycle, which is a reproductive cycle. The female reproductive system undergoes a number of hormonal and physical changes over the course of the cycle, which are what define it.
Proestrus, estrus, metestrus, and diestrus are the four phases that make up the estrous cycle. Each phase is distinguished by particular physiological and hormonal changes that get the female ready for sex and potential pregnancy.
Proestrus is the first stage of the estrous cycle. The follicular cells in the ovaries emit the hormone oestrogen during this period, which promotes the growth of follicles.
To know more about estrous click here
brainly.com/question/9531456
#SPJ4
what of the following statements best characterizes general intelligence during adolescence?
Adolescence is characterised by five main traits: bodily growth and development, an undefined position, greater decision-making, increased pressures, and the search for oneself.
Intelligence remains constant, but the underlying brain processes that support intelligence dramatically advance. Adolescence has been defined as the time in a person's life when they are no longer children but also not quite adults. An individual goes through significant physical and psychological changes during this time. Also, the teenager goes through changes in social expectations and beliefs. Sexual maturation goes hand in hand with physical growth and development, frequently resulting in romantic partnerships.
Adolescence, the stage of life between childhood and adulthood, is difficult and marked by observable changes in one's physical appearance, mental health, emotional state, social interactions, and behavioural patterns.
Learn more about Adolescence here:
https://brainly.com/question/3501577
#SPJ1
a kind of mutation that can change every amino acid that follows the point of mutation is called ?
A frameshift mutation is a type of mutation that can alter every amino acid that follows the point of mutation. It occurs when a single nucleotide is inserted or deleted within a gene sequence. This insertion or deletion alters the reading frame of the gene, resulting in a different sequence of amino acids which can have serious consequences.
For example, if a single nucleotide is inserted, the amino acid sequence will be shifted forward by one codon, resulting in a completely different protein product.
Similarly, if a single nucleotide is deleted, the amino acid sequence will be shifted backward by one codon, resulting in a completely different protein product. Frameshift mutations can cause a wide range of problems, from minor phenotypic changes to complete loss of function.
For example, a frameshift mutation in a gene that codes for a hormone receptor could lead to the cell not being able to recognize the hormone, resulting in the cell not performing its usual function. As such, frameshift mutations can have serious consequences and can result in serious diseases.
Know more about frameshift mutation here
https://brainly.com/question/14364090#
#SPJ11
Sort each description by the type of RNA it describes (tRNA, mRNA, rRNA).
a) contains an anticodon
b) specifies the amino acid sequence for a protein
c) contains exons
d) has amino acids covalently attached
e) is a component of ribosomes
f) is the most abundant form of RNA
Multiple choice:
A) a, b, d - TRNA, c - MRNA, e, f - FRNA B) a, c - TRNA, b, d - MRNA, e, f - rRNA C) a, e, f - FRNA, b - mRNA, c, d - TRNA D) None of the above
RNA it describes (tRNA, mRNA, rRNA) a, b, d - tRNA, c - mRNA, e, f - rRNA. The Correct option A)
a) Describes tRNA, which contains an anticodon that base-pairs with a codon on mRNA during translation to bring the correct amino acid to the growing protein chain.
b) describes mRNA, which specifies the order of amino acids in a protein by carrying the genetic information from DNA to the ribosome during translation.
c) describes mRNA, which contains exons that code for amino acids and introns that are spliced out during processing.
d) describes tRNA, which has an amino acid covalently attached to it that matches the anticodon sequence.
e) describes rRNA, which is a component of ribosomes along with proteins and assists in the binding and positioning of mRNA and tRNA during translation.
f) describes rRNA, which is the most abundant type of RNA and constitutes a large proportion of the ribosome.
Therefore, the correct answer is C) a, e, f - FRNA, b - mRNA, c, d - TRNA.
Learn More about RNA
https://brainly.com/question/25979866
#SPJ4
Although solar energy could supply all of the world's energy needs, why isn't it used to do so
There are several reasons why solar energy is not currently used to supply all of the world's energy needs: Cost, Infrastructure, Weather-dependent, Energy storage, and Political and economic factors.
Cost: The initial cost of installing solar panels and other solar technologies can be expensive, which can be a barrier for many people and countries.
Infrastructure: Solar energy requires a significant amount of land and infrastructure to be effective. It can be difficult to find suitable locations for solar farms, and there can be resistance from local communities to large-scale solar installations.
Weather-dependent: Solar energy production is dependent on the availability of sunlight, which can be affected by weather patterns such as clouds, rain, and snow. This can make solar energy less reliable than other forms of energy production.
Energy storage: Solar energy production can exceed demand during peak production times, which means that energy storage solutions are needed to provide power during times when sunlight is not available.
Political and economic factors: The fossil fuel industry has significant political and economic power, which can make it difficult to transition to renewable energy sources like solar.
To know more about solar energy here
https://brainly.com/question/9704099
#SPJ4
neon is a non-reactive gas that does not interact with other elements. How does the properties of neon compare to those of xenon? Why?
This means that because they already contain the required eight total s & p electrons at their outermost energy level, they do not interact with other elements.
Describe an element in its simplest form.A crucial component of a whole. a simple molecule that cannot be divided into smaller components or transformed into another substance is referred to as in chemistry. An atom, which is made up of protons, neutrons, and electrons, is the fundamental unit of an element.
How is an element created?Substances that cannot be reduced to a simplified form are considered elements. A distinct atomic number serves as an identifying feature. In the atomic numbers, which emphasizes elements with related properties, the elements are arranged according to their atomic number.
To know more about Elements visit:
https://brainly.com/question/13025901
#SPJ1
What are the three things all cells have in common?
which is a true statement about ribosomes? multiple choice polyribosomes are the subunits of ribosomes. ribosomes are active in carbohydrate synthesis. ribosomes contain dna and protein. ribosomal subunits leave the nucleus after being formed by the nucleolus. ribosomes are only found associated with the endoplasmic reticulum in prokaryotic cells.
Answer:
there
Explanation:
Ribosomal subunits leave the nucleus after being formed by the nucleolu
Ribosomes are composed of two subunits, the large and small subunits, which are produced in the nucleolus of the nucleus. The true statement about ribosomes is ribosomal subunits leave the nucleus after being formed by the nucleolus.
Ribosomes are responsible for protein synthesis in the cell. After their formation, the ribosomal subunits leave the nucleus and come together in the cytoplasm or on the endoplasmic reticulum to form functional ribosomes.
This process allows ribosomes to carry out their role in protein synthesis throughout the cell. The other statements in the options are not accurate.
Therefore, the true statement is ribosomal subunits leave the nucleus after being formed by the nucleolus.
For more information regarding ribosomes, visit:
https://brainly.com/question/9333250
#SPJ6
when isolating the solid after recrystallization using vacuum filtration what solvent should you use to aid in the rinse from the erlenmeyer flask to the vacuum filter funnel?
Use a nontoxic solvent to help with the rinse from the erlenmeyer flask to the vacuum filter funnel when vacuum filtering is being used to isolate the solid after recrystallization.
To get rid of any solvent contaminants that are on the crystals' surface during the recrystallization process, we keep the volume of the rinses low. The solvent should be non-volatile, non-flammable, and non-carcinogenic. The solvent should boil in the range 50–120°C.
Impurities should either be insoluble in the hot solvent or soluble in the cool solvent. The substance and solvent must not interact in any way. An ideal crystallization solvent should be unreactive, cheap, and have minimal toxicity. It is also vital that the solvent have a reasonably low boiling point.
Learn more about recrystallization Visit: brainly.com/question/30670227
#SPJ4
6. Cells combine with similar cells to form_______?
A big cell
O Organ
O Tissue
All of the above
Tissue.
Explanation:
Cells combine with similar cells to form Tissue.
Answer:
Tissue cells.
Explanation:
Similar cells, when combined together, form tissues, and similar tissues in turn form as part of a organ. When there are multiple organs inside a organism, it would be generally termed as a organ system.
~
Learn more about tissues, here:
https://brainly.com/question/13308565
Looking at the cross between a heterozygous and a homozygous dominant animal for the trait of hair color below. Black hair is dominant (B) to white hair (b). If the father has the genotype of (BB) and the mother has the genotype (Bb), describe how you would complete the Punnett square and then describe what the possible offspring's hair color could be based on the punnett square.
In complete dominance the dominant allele hides the expression of the recessive allele. Genotype: 50% homozygous dominant BB. 50% heterozygous Bb. Phenotype: 100% black hair.
What is complete dominance?
Complete dominance is an inheritance pattern that occurs when the dominant allele of a gene masks the expression of the recessive allele. This is evident in heterozygous individuals who carry both alleles and only express the dominant phenotype.
In the exposed example, B (black hair) is dominant over b (white hair)
Cross: father x mother
Parentals) BB x Bb
Gametes) B B B b
Punnett square) B B
B BB BB
b Bb Bb
F1) Genotype:
1/2 = 50% of the progeny is expected to be homozygous dominant BB
1/2 = 50% of the progeny is expected to be heterozygous Bb
Phenotype: 100% of the progenny is expected to express black hair
You can learn more about complete dominance at
https://brainly.com/question/1953851
#SPJ1
On the microscope is a rotating nosepiece that holds the ___________ lens that can magnify the object you are looking at on your slide.
Answer: objective lenses
Revolving Nosepiece or Turret: This is the part that holds two or more objective lenses and can be rotated to easily change power. Objective Lenses: Usually you will find 3 or 4 objective lenses on a microscope. They almost always consist of 4X, 10X, 40X and 100X powers.
Explanation:
what would probably happen to a male elephant that doesn’t have tusks?
Tusks are used to fight Elephants. A tuskless elephant's survival chances would be less due to competition.
What is competition in an ecosystem?Competition in an ecosystem refers to the interactions between organisms that compete for the same resources, such as food, water, shelter, or mates. These resources are often limited in availability. As a result, organisms that depend on them must compete with other members of their species or with other species.
Competition can occur within a species, known as intraspecific competition, or between different species, known as interspecific competition.
Tusks serve a variety of purposes for male elephants, including fighting for dominance, attracting mates, and foraging for food. Male elephants without tusks may face challenges in a particular area. They may have to depend more heavily on other means of communication and foraging, such as vocalizations and using their trunks to gather food.
Learn more about the competition, here:
https://brainly.com/question/8911564
#SPJ2