The science club and the French club both ordered pizzas for their end-of-year banquets. After the banquets, the science club had 1 1/4 pizzas leftover and the French club had 2 5/24 pizzas leftover. Between the two clubs, how many total pizzas were leftover?
A. 23/24

B. 1 1/4

C. 3 1/4

D. 3 11/24

Answers

Answer 1

Answer:

A. 23/24

Hope this helped

Step-by-step explanation:

Answer 2

Answer:

A. 23/24

Step-by-step explanation:

plato users


Related Questions

determine if the given equations are functions or not function

Answers

x = 3, y² = -5x -12, x² + y² =81. are all not functions. the others are functions.

Step-by-step explanation:

I just did it

A function assigns the values. The correct options are C and E.

What is a Function?

A function assigns the value of each element of one set to the other specific element of another set.

An equation is said to be a function if for each different value of x(input) it should give a different output. Therefore, for different inputs of x, the value of the output y should be different and unique. Also, the values if the equation produces the same output for two values of x it also said to be a function.

A.)

x = 3, since for every value of x the value is 3, which is not possible. Hence, this is not a function.

B.)

x² + y² = 81

For the given equation if the value of x is given as 0, the value of y will be,

x² + y² = 81

0² + y² = 81

y² = 81

y = ±√81

y = -9, 9

Hence, this can not be a function.

C.) y = -x + 11

For the given equation if the value of x is kept anything the value of y will be different. Thus, this is a function.

D.)

y² = -5x - 12

For the given equation if the value of x is given as less than -2.4, there will be two values of y. Thus, the given equation is not a function.

E.)

y = 2x² - 6x + 4

The given function will return will the same value of y for 2 different values of x. Hence, this is a function.

F.)

y = -7

Since the given equation can only have the value of y as 7. Therefore, it is not a function.

Hence, the equations that are a function are y = -x + 11 and  y = 2x² - 6x + 4.

Learn more about Function:

https://brainly.com/question/5245372

#SPJ2

If Art weighs 200 pounds at sea level, how much will he weigh on Mt. Everest, which is 29,035 feet above sea level? _ pounds

(Round answer to three decimal places. Do not round the numbers in your work. Only round the final answer)

If an object weighs m pounds at sea level, then its weight W (in pounds) at a height of h miles above sea level is given by W(h) = m(4000/(4000 + h))2. (1 mile = 5280 feet)

(W of h equals m times the quantity of (4000 over the quantity (4000 plus h)) squared)



If Art weighs 200 pounds at sea level, how much will he weigh on Mt. Everest, which is 29,035 feet above sea level?

Answers

Answer:

its 1,456,000

Step-by-step explanation:

first you multiply 200 times 5280 and add 4000 if thats right uon

PLEASE HELP ASAP! VERY DESPERATE
Michelle is making a poster for a class presentation. She plans to have four sections of information, each with a different background color. The diagram shows the lengths and widths of each section, where a is the length of the red section. Which expression for the area of the poster is written as the sum of the areas of each colored section? (answer choices are in the screenshot provided. thanks! <3)

Answers

Answer:

first option

Step-by-step explanation:

the area of a rectangle is

base*height

[tex]Purple=(3)\times(a)\\\\=3a\\\\\\Green=(\frac{1}{2})\times(3)\\\\=\frac{3}{2}\\\\\\Red=1\times a\\\\=a\\\\\\Yellow=\frac{1}{2}\times 1\\\\=\frac{1}{2}[/tex]

so the sum is

[tex]\Sigma A=3a+a+\frac{3}{2}+\frac{1}{2}[/tex]

which is the first option

The expression for the area of the poster is written as the sum of the areas of each colored section is 3a + a + 3 1/2 + 1/2

Area of a rectangle = length × width

Purple color:

Area = length × width

= 3 × a

= 3a

Red color:

Area = length × width

= 1 × a

= a

Green color:

Area = length × width

= 3 × 1/2

= 3 1/2

Yellow color:

Area = length × width

= 1 × 1/2

= 1/2

Sum of the areas = purple + red + green + yellow

= 3a + a + 3 1/2 + 1/2

Therefore, expression for the area of the poster is written as the sum of the areas of each colored section is 3a + a + 3 1/2 + 1/2

Read more:

https://brainly.com/question/17229451

HELP BAD DAY
Write as an expression:twice the product of the squares of x and y
with the product of the cube of a and the square of b

Answers

Answer:

the square root of 2(x^3 * x^2)

Step-by-step explanation:

twice means 2 and product means either division or multiplication (multiplication in this scenario because twice means multiply).  cubed means to the third power

The distribution of durations for which apartments remain empty after the resident moves out for one property management company over the past 10 1010 years was approximately normal with mean μ = 85 μ=85mu, equals, 85 days and standard deviation σ = 29 σ=29sigma, equals, 29 days. The property management company tags the files of the apartments that were empty for the shortest 5 % 5%5, percent of durations to have priority cleaning the next time their residents move out

Answers

A part of the question is missing which is;

What is the minimum duration for which an apartment remained empty for the company to update the kitchen appliances? Round to the nearest whole number.

Answer:

133 days

Step-by-step explanation:

We are given;

Population mean; μ = 85 days Population standard deviation; σ = 29 days

significance level; α = 5% = 0.05

Critical value of z at significance level of 0.05 = 1.645

Now, formula for z-score is;

z = (x - μ)/σ

Where x is the minimum duration for which an apartment remained empty for the company to update the kitchen appliances.

1.645 = (x - 85)/29

(1.645 × 29) = x - 85

47.705 = x - 85

x = 85 + 47.705

x = 132.705

x ≈ 133 days

Answer: 37 days

Step-by-step explanation:

Answer please 1st and second

Answers

1/9 x 12 is 4/3 or 1.333 repeated
The correct answer is 1.333

320÷b∙20 and 320÷(b∙20) for b=4

Answers

Answer:

Step-by-4vttbrbwtetbb4tbtb44tny4ny4nyn4tbryn4y

step explanation:

Indiana’s population has increased by 9.5% since 2000, when it was about 6 million people. What is Indiana’s population now?

Answers

Answer:

The answer is 3,166.7

Step-by-step explanation:

2,000*9.5 = 19,000

19,000/6 = 3,166.6666

Olly took a taxi 12 miles and paid $8.40. The cab driver charges $0.45 per mile after a flat fee. How much would it cost if Olly needed to take the taxi for 25 miles?​

Answers

Answer:

$14.25

Step-by-step explanation:

12 x 0.45 = 5.4

8.40-5.40=3

3 is the flat fee

3+(0.45 x 25) = 14.25

Answer:

$14.25

Step-by-step explanation:

8.40 = .45(12) + b

8.40 = 5.4 + b

b = 3

b = .45(25) + 3

b = 11.25 + 3

b = 14.25

Lincoln Cook has a check for $295.50 and a check for $6.25. He also has a $10.00 bill
He would like to receive $5.00 in cash and deposit the rest of the money in his say-
ings account. What is the total deposit?

Answers

Step-by-step explanation:

First, we need to add all the checks and money he has.

295.50

 10.00

   6.25

+________

  3   6  1  . 7 5

Total- $361.75

Now, we have to subtract 5 from this.

361.75

   5.00

-______

3 5 6 . 7 5

The total deposit is $356.75

Answer:

$306.75 is the right answer i just took the test.

Step-by-step explanation:

9e^2x - 30e^x + 25 = 0



Please I need a step by step solution urgently ​

Answers

Answer:

Here you go

Step-by-step explanation:

The first term is,  9e2  its coefficient is  9 .

The middle term is,  +30e  its coefficient is  30 .

The last term, "the constant", is  +25

Step-1 : Multiply the coefficient of the first term by the constant   9 • 25 = 225

Step-2 : Find two factors of  225  whose sum equals the coefficient of the middle term, which is   30 .

   

     15    +    15    =    30    That's it

Step-3 : Rewrite the polynomial splitting the middle term using the two factors found in step 2 above,  15  and  15

                    9e2 + 15e + 15e + 25

Step-4 : Add up the first 2 terms, pulling out like factors :

                   3e • (3e+5)

             Add up the last 2 terms, pulling out common factors :

                   5 • (3e+5)

Step-5 : Add up the four terms of step 4 :

                   (3e+5)  •  (3e+5)

            Which is the desired factorization

Write the following number in scientific notation: 0.0008228


PLEASE HELP QUICK

Answers

Answer:

0.0008228 to standard form =

8.228 x 10^-4

What is the missing reason in the proof?

given
transitive property
alternate interior angles theorem
converse alternate interior angles theorem

Answers

Answer:

c, alternate interior angles theorem

Step-by-step explanation:

if 1 is equal to 3, and 3 is equal to 2 by alternate interior angles theorem, then that should also apply to angle 1.

find the labeled angles​

Answers

Answer:

X = 25, Angles are 65 degrees

Step-by-step explanation:

3x-10 = x+40

2x=50

x=25

.4 ÷ 28.08 Dividing Decimals , Divide to the nearest Tenth??
I Will Give You 10 Points

Answers

Answer:

0

Step-by-step explanation:

The answer is 0.01424, but if you round it to the nearest tenth, you would end up with 0.

The difference between a number x and 3 is at least nine Write an inequality for the following sentence.

Answers

Answer:

3 - x ≥ 9

Step-by-step explanation:

At least in inequality means greater than or equal to (≥)

Difference in mathematics means subtraction

The difference between a number x and 3

3 - x

is at least nine

3 - x ≥ 9

The inequality for the sentence is

3 - x ≥ 9

how do you solve u = 3a/2 solving for a

Answers

Answer:

Step-by-step explanation:

a=2a/3. ✌️

The answer that I got is 2a/3


The annual profit at a chain of stores is normally distributed with a mean of $61,000 and a standard
deviation of $23,000. The stores in the top 5% of annual profit were rewarded with a celebration. What
was the annual profit required to have a party?

Answers

Answer: $98,835.

Step-by-step explanation:

Given: Annual profit at a chain of stores is normally distributed with a mean ([tex]\mu[/tex]) of $61,000 and a standard  deviation([tex]\sigma[/tex]) of $23,000.

Let [tex]x[/tex] denoted the profit.

Let [tex]x_0[/tex] be the minimum profit required to have a party.

The stores in the top 5% (i.e. 0.05) of annual profit were rewarded with a celebration.

i.e. [tex]P(x>x_0)=0.05[/tex]

[tex]\Rightarrow\ P(\dfrac{x-\mu}{\sigma}>\dfrac{x_0-61000}{23000})=0.05\\\\\Rightarrow\ P(z>\dfrac{x_0-61000}{23000})=0.05\ \ \ [z=\dfrac{x-\mu}{\sigma}]\\\\\Rightarrow\ \dfrac{x_0-61000}{23000}=1.645\ \ [\text{critical z-value for p-value 0.05=1.645}]\\\\\Rightarrow\ x_0-61000 =1.645\times 23000\\\\\Rightarrow\ x_0-61000 =37835\\\\\Rightarrow\ x_0=37835+61000\\\\\Rightarrow\ x_0=98835[/tex]

Hence, the annual profit required to have a party was $98,835.

Somebody please help!!

Answers

Answer:

-12

Step-by-step explanation:

Substitute x for 3

6(3-5)

Simplify in the parenthesis

6(-2)

multiply

-12


P(5. - 5), y=3x+3
Write an equation for the line in point-slope form

Answers

Answer:

M= 3

Step-by-step explanation:

l2ecdnienofnweucon fuovnewdionsdv wqueijncqodi

Answer:

y+5 =3(x-5)

Step-by-step explanation:

The point slope form of an equation is : y-y₁ = m(x-x₁)

Given in the question ;

x₁= 5

y₁ = -5

y= 3x+3 where m=3

The equation is :

y-y₁ = m(x-x₁)

y--5 =3(x-5)

y+5 =3(x-5) ----equation of the line in point-slope form.

Someone please help me

Answers

11. is X
12. is X and then +
13. is X and then + and then X

correct me if i’m wrong :)
For the 1st one you have the multiply

For the 2nd one I think you have to multiply then add 8x5+3=43

For the 3rd one I’m not quite sure about it

WILL MARK BRAINLIEST PLZ ANSWER FAST GUYS AND GIRLS. Don't mind the second question. You can answer it if you want that will help me.

Answers

Answer:

1. 10d + 5n = 85

2. look at graph  or graph coordinates (0, 17) and (8.5, 0) and make a line through them

3. 17 nickels since its only nickels, on the graph you see where the line hits the y-axis which is 17.

4. 8.5 dimes since its only dimes, on the graph you see where the line meets the x-axis which is 8.5

Step-by-step explanation:

y-axis is nickels

x-axis is dimes

Four movie tickets cost $40.00 dollars( look above for the rest of the question plss answer fast

Answers

Answer:

-7.5 US$

Step-by-step explanation:

that's how i got it =)

Answer: The answer is B

Step-by-step explanation:

Which rule best describes this transformation

Answers

Answer:

B

Step-by-step explanation:

What strategy would be the best to solve this problem? Ann-Marie bought apples. She kept one-third for herself and gave the rest to 4 friends. Each friend got 2 apples. How many apples did Ann-Marie buy? A. guess, check and revise B. work backwards C. use a formula D. look for patterns

Answers

Answer:

D. Look for patterns

Step-by-step explanation:

To solve :

Assume number of apples bought = x

Fraction kept = 1/3 of x

Fraction shared = (x - x/3) = (3x - x) /3 = 2x/3

Number of people who shared (2x/3) = 4 with each getting 2

Total number shared = 4 * 2 = 8

Fraction shared = total shared

2x/3 = 8

Multiply both sides by 3

(2x/3) * 3 = 8 * 3

2x = 24

x = 12

Hence, Anne-Marie purchased 12 apples

solve the equation. 4.6g +9+1.6g +21 what is g

Answers

Answer:

= 6.2g+9

Step-by-step explanation:

6.2g + 30 I cant solve for g since you didn’t provide what it equals

A car increases, then decreases, its speed. Which table could represent the speed of the car? A 2-column table with 5 rows. The first column is labeled time (minutes) with entries 5, 6, 7, 8, 9. The second column is labeled speed (miles per hour) with entries 45, 43, 41, 42, 43. A 2-column table with 5 rows. The first column is labeled time (minutes) with entries 5, 6, 7, 8, 9. The second column is labeled speed (miles per hour) with entries 45, 47, 49, 48, 47. A 2-column table with 5 rows. The first column is labeled time (minutes) with entries 5, 6, 7, 8, 9. The second column is labeled speed (miles per hour) with entries 45, 45, 45, 43, 41. A 2-column table with 5 rows. The first column is labeled time (minutes) with entries 5, 6, 7, 8, 9. The second column is labeled speed (miles per hour) with entries 45, 43, 41, 41, 41.

Answers

Answer:

The speed increases (45—>47—>49) then decreases (48—>47) over time.

Step-by-step explanation:

HOPE THIS HELPED ✨

Answer: The speed increases (45—>47—>49) then decreases (48—>47) over time.

1/3 kilograms 2/3 what is the unit rate

Answers

Idk I download this app so other ppl can help me

The parent function f(x) = x^2 is vertically stretched by a scale factor of 2, translated 14 units right, and 6 units up. Which equation below represents the new equation? 1. G(x) = 2(x-14)^2 + 6 2. G(x) = 1/2 (x-14)^2 = 6 3. G(x) = 2(x-14)^2 - 6 4. G(x) = 2(x+14)^2 + 6

Answers

Answer:

[tex](1)\; G(x)=2(x-14)^2+6[/tex]

Step-by-step explanation:

Assuming, right and up are positive directions.

The given parent function, [tex]f(x)=x^2[/tex]

Let [tex]f_1(x)[/tex] be the function when the parent function is stretched by a scale factor of 2.

So, [tex]f_1(x)=2f(x)[/tex]

[tex]\Rightarrow f_1(x)=2x^2[/tex]

Let [tex]f_2(x)[/tex] be the function when [tex]f_1(x)[/tex] is translated [tex]14[/tex] units right.

So, [tex]f_2(x)=f_1(x-14)[/tex]

[tex]\Rightarrow f_2(x)=2(x-14)^2[/tex]

Again, let [tex]f_3(x)[/tex] be the function when [tex]f_2(x)[/tex] is translated 4 units up.

So, [tex]f_3(x)=f_2(x)+6[/tex]

[tex]\Rightarrow f_3(x)=2(x-14)^2+6[/tex]

So, the resulting function, [tex]f_3(x)=G(x)=2(x-14)^2+6[/tex].

Hence, option (1) is correct.

10) Which of the following best represents the
range of the graph below?
A) -2 y <3
B) y
ya
C) y2-3
D) All real numbers

Answers

B .....................
Other Questions
If x+5=20, what does X+10 equal? What is mass? In matter and energy A student records a physical property of a rock as 2.2N. Which physical property has the student measured? What does Beowulf foresee concerning Freawarus marriage Carbon decays every 5700 years. If you found a rock containing Carbon that has gone through 2.5 half lives, how old is that rock? Love after Love By Derek Walcott What are machines fueled by?1. Energy 2. Electricity only3. gasoline only4. Sun You measure containers for international shipments. The height of the standard container is 6 feet and 7 inches. What is the height in meters? TIME REMAINING52:45The robotic rover Curiosity has instruments that detect radiation both inside the spacecraft and in the Mars environment. What is most likely the purpose of this radiation detection?to determine whether human exploration of Mars is possibleto develop better X-ray technologyto find evidence of once-living Martian microorganismsto investigate evidence of hydrogen and water (1/3)^2=? I need help with math I'm failing, because of my teacher By finding out who Figaro's parents are how does this inconvenience the Count? Starting from rest, a car travels 18 meters as it accelerates uniformly for 3.0 seconds. What is the magnitude of the car's acceleration? A. 6.0 m/s2 B. 2.0 m/s2 C. 3.0 m/s2 D. 4.0 m/s2 78There are 32 desks in a room.If x represents the number of rows of desks, which expression would equal the number of desks in each row?0 32 + x32 - xO 320 3/x Rafael can type 24 words in 6 minutes. What is his rate in words per minute what happen when two light waves traveling from oppsite direactions meet? if a doctor states that a patient has a bone break in the left anterior portion of their body, lateral to midline in their thoracic cavity, what can you assume im broken? In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services.