URGENT PLS!!

The equation of the line passing through the points (2,1) and (-6, -5) is given by ax+by=10. What is the value of a?​

Answers

Answer 1

Answer:

a=15

Step-by-step explanation:

URGENT PLS!!The Equation Of The Line Passing Through The Points (2,1) And (-6, -5) Is Given By Ax+by=10.

Related Questions

Multiple Choice

2. Match the graph to the table of values.
The first quadrant of a coordinate plane is shown with four plotted points.The x-axis is titled 'Time in seconds,' and the y-axis is titled 'Height in meters.' The four points resemble a layout similar to a checkmark with the first point located slightly higher than the second point. The second, third, and fourth points follow a linear pattern with a positive slope.
A.
Time (s) Height (m)
1

5

2

10

3

15

4

20

B.
Time (s) Height (m)
1

2

2

3

3

5

4

9

C.
Time (s) Height (m)
1

4

2

3

3

5

4

7
Multiple Choice

Match the graph to the table of values.
The first quadrant of a coordinate plane is shown with four plotted points. The x-axis is titled 'Time in seconds,' and the y-axis is titled 'Height in meters.' The four points start in the lower left corner of the first quadrant and follow a linear pattern with a positive slope.

A.
Time (s) Height (m)
1

5

2

10

3

15

4

20

B.
Time (s) Height (m)
1

2

2

3

3

5

4

9

C.
Time (s) Height (m)
1

4

2

3

3

5

4

7

100 POINTS FOR ANSWERS AND EXPLANATION! PLS I NEED HELP ASAP! Thanks!

Answers

Answer:

Step-by-step explanation:

Choice A: t=1, h=5; t=2, h=10

Choice B: t=1, h=2; t=2, h=3

Choice C: t=1, h=4; t=2, h=3

ans is C as it fits the descriptions

Choice A: t=1, h=5; t=2, h=10; t=3, h=15

Choice B: t=1, h=2; t=2, h=3; t=3, h=5  <== non-linear

Choice C: t=1, h=4; t=2, h=3; t=3, h=5 <== non-linear

ans is A as it fits the descriptions

Help
What is the angle measurement of the missing angle in the picture below?

Answers

Answer:

68⁰

Step-by-step explanation:

90 + 22 = 112

180 - 112 = 68


Eight candy bars cost $6.00. How many candy bars cost $27.00?

Answers

Answer:

36 candy bars. (32 if sold in packs)

Step-by-step explanation:

We know that eight candy bars cost 6 dollars, and we purchased $27 dollars worth of them.

Therefore, we can use 27/6 = 4.5 to see how many packs/sets of candy bars we purchased. Since there are 8 in a pack/set, we do 8x4.5 = 36 to see we can purchase 36 candy bars. However, if you can only buy them in packs of 8, then you can only purchased 4 packs/32 bars since 6x5 = 30 and we only have 27 dollars.

Answer:

I pretty sure it's 36 Candy bars (i think)

Step-by-step explanation:

Natalia paid $38.95 for three medium-sized pizzas and a salad. If Natalia paid $11.98 for the salad, how much did each pizza cost? Enter your answer in the box.

Answers

Answer:

$8.99

Step-by-step explanation:

30PTS 30PTS don’t explain just answer

Answers

Answer:

y = 95°

Step-by-step explanation:

x + 120° = 180°

x = 180° - 120°

x = 60°

25° + y + x = 180°

25° + y + 60° = 180°

y + 85° = 180°

y = 180° - 85°

y = 95°

Find the expected value of the winnings
from a game that has the following
payout probability distribution:
Payout ($)| 0
2
4
6
10
Probability 0.5 0.2 0.15 0.1 0.05
Expected Value = [?]

Answers

0*.5+2*.2+4*.15+6*.1+10*.05= 2.1

The expected value of the winnings from a game is 2.1.

What is expected value?

Expected value is used when we want to calculate the mean of a probability distribution. The weighted average of possible values of a random variable, with weights given by their respective theoretical probabilities, is known as the expected value.

For the given situation,

Payouts, x = 0, 2, 4, 6, 10

Probabilities, P(x) = 0.5, 0.2, 0.15, 0.1, 0.05

The formula of expected value is [tex]E ( X ) = \mu = \sum [xP( x )][/tex]

⇒ [tex]E(X)=(0)(0.5)+(2)(0.2)+(4)(0.15)+(6)(0.1)+(10)(0.05)[/tex]

⇒ [tex]E(X)=0+0.4+0.6+0.6+0.5[/tex]

⇒ [tex]E(X)=2.1[/tex]

Hence we can conclude that the expected value of the winnings from a game is 2.1.

Learn more about expected value here

https://brainly.com/question/24321198

#SPJ2

What are the 3 possible solutions for any quadratic?

Answers

There are three basic methods for solving quadratic equations: factoring, using the quadratic formula, and completing the square.

quadratic equations

Quadratic equations are the polynomial equations of degree 2 in one variable of type f(x) = ax^2 + bx + c = 0 where a, b, c, ∈ R and a ≠ 0. It is the general form of a quadratic equation where 'a' is called the leading coefficient and 'c' is called the absolute term of f (x).

factoring

factorization or factoring consists of writing a number or another mathematical object as a product of several factors, usually smaller or simpler objects of the same kind.

Learn more about quadratic equations here :-

https://brainly.com/question/30098550

#SPJ4

Which expression is the factored form of 2x^2 7x 3?

Answers

The factored form of quadratic equation 2x² + 7x + 3 is 2(x + 1/2) (x + 3)

A quadratic equation can be expressed in:

- Standard form: y = ax² + bx + c

- factored form: y = a(x - x₁) (x - x₂)

Here, x₁ and x₂ are the roots of the given function.

Suppose we are given a quadratic equation:

y = ax² + bx + c

To find the factored form, use the following properties:

x₁ . x₂ = c/a

x₁ + x₂ = - b/a

In this case, the quadratic function is:

y = 2x² + 7x + 3

We have to find x₁ and x₂ such that:

x₁ . x₂ = 3/2

x₁ + x₂ = - 7/2

Hence,

x₁ = - 1/2

x₂ = - 3

Therefore the factored form is:

y = 2(x + 1/2) (x + 3)

Your question is incomplete, but most probably your question was:

Which expression is the factored form of 2x² + 7x + 3?

Learn more about quadratic equation here:

https://brainly.com/question/29280392

#SPJ4

Please help!!!! I'LL GIVE 5 STAR RATING AND A THANKS

Answers

Answer:

9.1

Step-by-step explanation:

For the first one, I just multiplied 4.55 and 0.5 by 2 somthey are proportional. Or divide distance by time!

3. At the grocery store, three flavors of Cheerios are sold.

Flavor A is 20 ounces and costs $4.49. The unit rate is ------------- per ounce.

For Flavor B, the equation y = 0.20x represents the cost (y) per ounce (x) in each box. The unit rate is------------------------ per ounce.
For Flavor C, the table below shows the amount paid per ounce. The unit rate is ---------------------- per ounce
Ray is making bouquets of balloons. In each bouquet 2 out of every 5 balloons are red. Write an equation to help Ray determine how many red balloons are needed compared to the the total number of balloons used.

7. Let x represent the number of balloons used compared to y which is the number of red balloons.
10.
Review the keywords below. Find at least 2 words commonly used for "Rate of Change". Drag and Drop them to the box for "Rate of Change" to earn full credit.

Answers

The unit rate of flavor A is; $0.2245 per ounce

The unit rate of flavor B is; $0.20 per ounce

An equation to help Ray determine how many red balloons are needed compared to the the total number of balloons used is; y = ²/₅x

How to find the unit rate?

A unit rate is also called unit ratio and it describes how many units of the first type of quantity corresponds to one unit of the second type of quantity.

We are given that Flavor A is 20 ounces and costs $4.49. Thus;

Unit rate of flavour A = $4.49/20 = $0.2245 per ounce

For Flavor B, the equation y = 0.20x represents the cost (y) per ounce (x) in each box. Thus, the unit rate is $0.20 per ounce

Since ray is making bouquets of balloons. In each bouquet 2 out of every 5 balloons are red.

If x is the number of ounces, then the unit rate is 2/5 . Thus, the equation is; y = ²/₅x

Read more about Unit rate at; https://brainly.com/question/19493296

#SPJ1

Pls help will give brainlest if it’s right

Answers

The answer is Public Service

Solve for brainliest :P

Answers

Answer: x= 6 y= -3

Step-by-step explanation:

Answer:

x=-96/15

y=-3

Step-by-step explanation:

this is the correct answer for sure

I have no idea what to do can someone help

Answers

Answer:

k = 20

can i have brainliest

Step-by-step explanation:

K=20 would be the answer

What is the diameter of the circle?

A) 6 inches
B) 24 inches
C) 26 inches
D) 48 inches

Answers

Answer:

24 inches

Step-by-step explanation:

diameter = 2× radius

diameter =2×12

diameter =24 inches

Answer:

24

Step-by-step explanation:

multiply radius by 2 and you will get the diameter

The the radius is also Half diameter

I hope this helped!

Emily invested $2,000 in an account at a 3.5% interest rate. She kept the money in her account for four years. Determine, to the nearest dollar, the balance in the account after four years.

Answers

Answer:

$280

Step-by-step explanation:

$2000 * 3.5% * 4 = $8000 * 0.035 = $280

2000 x .035 = 70, 4 years= 4 times so 70 x 4
=280
Now Emily has invested 2000 so she started with 2000 plus the interest rates her account made
Final answer = 2280

Add the following polynomials, then place the answer in the proper location on the grid. Write the answer in descending powers of a. Add: 3a 3 8a - 6 and 4a 2 - 9a 11

Answers

Adding the polynomial 3a³ + 8a - 6 and 4a² - 9a + 11 gets 3a³ + 4a² - a + 5.

The answer in descending powers of a is 3a³ + 4a² - a + 5.

A polynomial is a mathematical expression consisting of a sum of powers in one or more variables (indeterminates) with non-negative integer exponents.

Adding the polynomial 3a³ + 8a - 6 and 4a² - 9a + 11                                        

(3a³ + 8a - 6) + (4a² - 9a + 11) = 3a³ + 4a² - a + 5

The coefficients of  a³, a², a and 1 is 3, 4, -1 and 5 respectively.                      

Descending powers of a in the polynomial is a³, a², a. So the answer in descending powers of a is 3a³ + 4a² - a + 5.

--The question is incomplete, answering to the question below--

"Add the following polynomials, then place the answer in the proper location on the grid. Write the answer in descending powers of a.

Add: 3a³ + 8a - 6 and 4a² - 9a + 11"

To know more on polynomial

https://brainly.com/question/22236183

#SPJ4

is the relationship between the variables in the table an inverse variation or a direct variation? write an equation to model it.

x= 2 6 7 14
y= 21 7 6 3

Answers

The relationship between the variables in the table is an inverse variation The equation to model is y = 42/x.

What is an equation?

An equation is a mathematical statement that is made up of two expressions connected by an equal sign.

Example:

2x = 8 is an equation.

We have,

x:  2  6  7  14

y: 21  7  6  3

Now,

When x = 2, y = 21

This can be written as,

y = kx

21 = 2k

k = 21/2

The equation is y = (21/2)x _____(1)

or

y = k/x

21 = k/2

k = 42

The equation is y = 42/x _____(2)

Now,

We will check which equation fits the table.

From (1)

y = (21/2)x

When x = 6,

y = (21/2) x 6 = 21 x 3 = 63

From (2),

When x = 6,

y = 42/6 = 7

When x = 7,

y = 42/7 = 6

When x = 14,

y = 42/14 = 3

This equation satisfies the table.

Thus,

The relationship is an inverse variation.

The equation is y = 42/x.

Learn more about equations here:

https://brainly.com/question/17194269

#SPJ1

Find the area of a triangle that has a base of 10 inches and a height of 7 inches.
A) 8.5 in2
B) 17 in2
C) 35 in2
D) 70 in2
Also sorry for asking 2 questions in one day :'D

Answers

C. 35 in2

10*7=70

70/2= 35

What is the domain of the function y=5√6−2x​

Answers

The domain is all values of x that makes the expression defined.

Set-Builder Notation: {x| x ≤ 3 }

Interval Notation: (-∞,3]

What is the domain of the given function?

Given the function in the question;

y = 5√(6−2x)​

To find the domain, set the radicand greater than or equal zero and solve for x.

6 - 2x ≥ 0

Subtract 6 from both sides

6 - 6- 2x ≥ 0 - 6

-2x ≥ -6

Divide both sides by -2

-2x/-2 ≤ -6/-2

x ≤ -6/-2

x ≤ 3

Therefore, the domain is;

Set-Builder Notation: {x| x ≤ 3 }

Interval Notation: (-∞,3]

Learn more about domain here: https://brainly.com/question/28135761

#SPJ1

A population has a standard deviation x=18.4. How large a sample must be drawn so that a 98% confidence interval will have a margin of error equal to 4.1?

Answers

Answer:

"109" will be the appropriate response.

Step-by-step explanation:

The given values are:

Standard deviation,

[tex]\sigma=18.4[/tex]

Margin of error,

[tex]E = 4.1[/tex]

Using the table,

[tex]Z_{(\frac{0.02}{2} )}=2.326[/tex]

Now,

The sample size will be:

⇒  [tex]n=(\frac{Z_{(\frac{0.02}{2})\times \sigma}}{E} )^2[/tex]

On substituting the values, we get

⇒      [tex]=(\frac{2.326\times 18.4}{4.1} )^2[/tex]

⇒      [tex]=(\frac{42.7984}{4.1} )^2[/tex]

⇒      [tex]=(10.4386341)^2[/tex]

⇒      [tex]=109[/tex]

what a quadrilateral with two sets of parallel lines that are Opposite sides are parallel.

Answers

There are many special types of quadrilateral. A parallelogram is a quadrilateral in which both pairs of opposite sides are parallel .

Hope this helps!

In Mohammad’s class, 80% of the students are boys. There are 24 boys in the class. What is the total number of students in Mohammad’s class?

Answers

Answer:

30 students

Step-by-step explanation:

80%  of  N   =   24            where N  is  the total number of students

So

.80 N   =  24

N =  24 /  .80     =      30

sorry this was a late response

Triangle GHI is similar to triangle JKL. Find the measure of side JK. Round your answer to the nearest tenth!

Answers

Given: Two triangle AGHI AJKL.

To find: measure of side JK and round the answer nearest tenth.

Solution: from figure

IH=5, GH=8,LK=16 from similarity rule

IH/LK=GH/JK

5/16 = 8/x

⇒5x=16x8

x=16×8/5

⇒x=25.6 or

x= 26 (nearest tenth), this is side JK

Definition of Triangle

A triangle is a type of polygon, which has three sides, and the two sides are joined end to end is called the vertex of the triangle. An angle is formed between two sides. This is one of the important parts of geometry.

Some major concepts, such as Pythagoras theorem and trigonometry, are dependent on triangle properties. A triangle has different types based on its angles and sides.

Shape of Triangle

Triangle is a closed two-dimensional shape. It is a three-sided polygon. All sides are made of straight lines. The point where two straight lines join is the vertex. Hence, the triangle has three vertices. Each vertex forms an angle.

Learn more about triangle at https://brainly.com/question/2773823.

#SPJ4

Find the domain and range of the graph

A. D: X ≤ 5
R: y ≤ 7


B. D: X ≤ 7
R: y ≤ 5

C. D : X < 5
R: y < 7

D. D: X < 7
R: y < 5

Answers

General Formulas and ConceptsAlgebra I

Domain

The set of x-values that can be inputted into function f(x)

Range

The set of y-values that are outputted by function f(x)

Interval Notation

ApplicationStep 1: Define

Let's organize what is given to us from the problem.

We are given a graph of a function.

Step 2: Solve

We need to analyze the graph to determine the domain and range of the graph.

If we take a look at our x values, we see that our graph starts at x = 3 and continues infinitely.

∴ we can write the graph's x-values as [3, ∞), or x ≥ 3.

⇒ The domain of the graph is equal to x ≥ 3.

If we take a look at our y values, we see that our graph begins at y = 1 and also continues infinitely.

∴ we can write the graph's y-values as [1, ∞), or y ≥ 1.

⇒ The range of the graph is equal to y ≥ 1.

Answer

∴ the answer to the question is equal to:

A. D: x ≥ 3

    R: y ≥ 1

___

Learn more about functions: https://brainly.com/question/30200855

Learn more about Algebra I: https://brainly.com/question/16898384

___

Topic: Algebra I

Unit: Functions

A car can travel 56 miles on 4 gallons of gas. How far can the car travel on 20 gallons of gas?

NO LINKS BOTS!

Answers

I think the answer is 280
The answer is 280.

Explanation:

56 divided by 4 is 14.

14 x 20 = 280.

subtract x2+2x+1-(x-3)

Answers

Answer:

(x to the second power)+x+4

Step-by-step explanation:

Ur welcome

a stadium is filled to 80% capacity. If 2,560 people are in the stadium, how many people would fill the stadium to its full capacity?

Answers

2048 people would fill the stadium to its full capacity

What is Percentage?

percentage, a relative value indicating hundredth parts of any quantity.

Given that a stadium is filled to 80% capacity

There are  2,560 people are in the stadium

We need to find how many people would fill the stadium to its full capacity.

We have to convert 80% to decimal by dividing 2560 with 100

80/100

0.8

Now multiply 0.8 with 2560

0.8×2560

2048

Hence, 2048 people would fill the stadium to its full capacity

To learn more on Percentage click:

https://brainly.com/question/28269290

#SPJ1

When merida divides her age by 3 and adds 5, the result is 9 which equation represents this situation where m is meridas age?

a/ 9= (m ~ 3) x 5
b/ m= (9 - 3 ) + 5
c/ m = (9~3) +5
d/ 9= (m~ 3) +5

Answers

When Merida divides her age by 3 and adds 5, the result is 9, now the equation becomes: 9 = (m + 3) ÷ 5.

What is an equation?

The link between two expressions on each side of the sign is represented by a mathematical equation. One variable and an equal sign are often present.

The definition an equation in algebra is a mathematical expression that indicates the equivalence of two mathematical terms. In equation 6x + 11 = 14, for instance, the two expressions 6x + 11 and 14 are separated by the symbol "equal."

When Merida divides her age by 3 and adds 5, the result is 9, now the equation becomes: 9 = (m + 3) ÷ 5, this represents the situation where m is Merida's age.

correct option: D

To know more about equation refer to:

brainly.com/question/17145398

#SPJ1

If you thanks my answers I will give brainliest and thanks back

Answers

Answer:

deal

Step-by-step explanation:

Answer: for real. I give you a thanks in your answer I will give you more please give me a Brainliest I really needed it :D

Step-by-step explanation:

If $x$ is a positive multiple of 8 and $x^2>100$, but $x<20$, what is $x$?

Answers

Answer:

16

Step-by-step explanation:

16 is a positive multiple of 8, in which 16²=256>100 and 16<20 are true statements.

Answer:

[tex]$x=\boxed{16}$[/tex]

Step-by-step explanation:

Since $x$ is a positive multiple of 8, it must be at least 8. Since $x^2>100$ and $x$ is at least 8, the only solution is $x=16$.

To verify this, note that $x=8$ does not satisfy the inequality $x^2>100$, but $x=16$ does, so $x=16$ is the only solution that works.

Therefore, $x=\boxed{16}$.

Other Questions
Find the area. The figure is not to scale You can NOT have an in group without having an out group True False 3 chairs and 4 tables cost rs 7540. if the price of a chair is 220 find the price of table?ans - 7120 two equivalent ratios for 17:5? Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA The table below shows information about how many fans there were at twofootball matches in a local tournament.What is the difference between the number of away fans at the semi-final and atthe final?Semi-finalFinalTotal number of fans250400Ratio of home fansto away fans6:47:3 Follow the constitution and the law even if I disagree with it what power or duty is this listed on Nika rolls an 8-sided cube with faces numbered 1 through 8. Which of the following statements is true? P(even number) = P(odd number) = P(number less than 8) = 1P(the number 9) = 1 Why might Great Britain's colonies have contributed tothe start of Ine Industrial Revolutionin Great Britain? What is irony What are the 3 types of irony and examples of each? Which question is a statistical question?A. How tall is the oak tree?B. How much did the oak tree grow in one year?C. What are the heights of the oak trees in the schoolyard?D. What is the difference in height between the oak tree and the pine tree? HELP FOR MY FINAL PLEASE PLEASE In a random sample of 70 people, it was found that 44 of them were fans of the New York Yankees. What is the margin of error for the true proportion of all individuals who are fans of the New York Yankees? A. 0.0088 B. 0.058 C. 0.063 D. 0.116 E. 0.173 Which sentence is the most formal?A. Hi! Do you have any job openings at your work yet?O B. I would like to apply for the administrative position at yourcompany.C. I think it would be really fun to work at your company.D. Please hiring my person for the open position you got in yourestablishmentLIDT TCS the scrum team is using the KANBAN board to make work visually availible to all. What cannot be inferred from the board You can find Maya Angelou's many poetry volumes in most bookstores. What word or phrase is modified by the prepositional phrase in this sentence? What statements about prisms are always true if the top base is directly above the bottom base? Select all that apply. The lateral faces are rectangles. The bases are congruent. The bases can be any shape. The lateral faces are congruent. What is the function of a claim in an argument evaluating an argument? Did slaves have unalienable rights? Categories of books that focus on various aspects of human nature are known as A. genres.B. novelsC. novellas. D. themes.