what is the answer to this question marking brainliest if correct Explain​

What Is The Answer To This Question Marking Brainliest If Correct Explain

Answers

Answer 1

C

Explanation

..............

Answer 2

Answer:

D.

Explanation:

It has the best sound,

"Once, the Watson family was awakened early by a loud crash coming from the kitchen. Suddenly, they all figured out it was their pesky cat. Earlier they heard robotic beeps and knew it was not the sound of their cat.


Related Questions

"Wretch, I cried, 'thy God hath lent thee-by these angels he hath sent thee /
Respite respite and nepenthe from thy memories of Lenore!"
The lines above demonstrate the use of in "The Raven."
A. theme
B. apostrophe
OC. enjambment
D. paradox

Answers

Answer:

'The Raven' is a popular narrative poem, that centers around the theme of loss. The narrative of the poem opens the door to self-analysis.

Explanation:

Read this excerpt from a passage.
I'm a normal high school kid--that is, I'like listening to music. Until about a year
ago, I always liked listening to it loud. Loud enough that it filled up my head and
pulsed through my body, so the boundary between me and the music disappeared.
I've listened to countless hours of music-vibrant music pouring into my ears from
headphones, washing over me from car speakers, or blasting at me from gigantic
speakers at concerts.
What is the author's point of view in the excerpt?
a) third-person omniscient
b) third-person limited
Oc) second person
d) first person

Answers

Answer:

D) first person

Explanation:

The author is using 'I', which is the indication that they're using first person. Hope this helps!

The author's point of view in the excerpt is the first person. So, the correct option is d.

What is meant by point of view ?

Point of view can be defined as the writer's way of describing the characters of a story as if who is telling the story.

Here,

The author is describing in the excerpt, that about how he loves to listen music and his way of listening it.

It is clearly visible that, he is defining himself as the main character of the story.

The author is always using "I" to represent the character. So that, we can say that according to the point of view of the author, he if the first person depicted as the character who is narrating the story.

Hence,

The author's point of view in the excerpt is the first person.

To learn more about  point of view, click:

https://brainly.com/question/20179316

#SPJ5

35 POINTS PLZ HELP!
ESSAY: LOST CONTINENT
Reread part 2, chapter 9. Write at least 250 words on the attitude of Captain Nemo or Aronnax on the lost continent. Find evidence for what you want to say. Be careful of contradictory evidence.

Here is your goal for this assignment:

Write a character analysis.


Your essay should answer the following questions using your own ideas supported with direct quotes from the text. Use at least one paragraph to answer each question but tie them together into one coherent essay by using transitions and linking ideas.

1. What is the attitude displayed by Nemo or Aronnax concerning their general outlook on the world?

2. How do you know? What does Verne have his characters say and/or do that reveal that attitude.

3. How do you think that attitude affected the outcome of the novel? Did that attitude contribute to the fate of the character?
You will be graded on the following criteria:

1. Clearly state your thesis, and support it with evidence from the text. Use at least three specific quotes. Remember to document your evidence properly, using MLA format (click here to review the MLA Style Guide).

2. Make sure each paragraph contains one main idea and support. Use complete sentences including compound and complex sentences.

3. Include an introductory paragraph, proper transitions, and an appropriate conclusion.

4. Make sure your essay contains no errors in conventions such as spelling and grammar errors, and is at least 250 words long.

Answers

Answer:

https://studycorgi.com/captain-nemo-on-the-lost-continent/

This question requires writing an essay on character analysis of characters in Lost Continent. Here is a guide to help you:

Read the story on Lost Continent in-depth and note down some of the attitudes of Captain Nemo and Aronnax.Outline the attitudes you discovered from both characters.Give concise and concrete evidence about them avoiding contradiction.Buttress your points clearly.

What is essay?

An essay actually refers to a piece of writing that is done by an writer in order to buttress or show his point of view on a subject matter. Essays help readers to get the perspective of a writer who is narrating, informing, arguing, or exposing a concept or situation.

We can see that the above guide will help you write an essay on character analysis.

Learn more about essay on https://brainly.com/question/598316

The passage below (paragraph 3) adds to the development of the text mainly by The turn to realism can be seen as a response to the American Civil War. After the bitter war ended, Americans viewed their lives differently. Th began to question their ideas about religion, society, and what it meant to be American. Realists took a down-to-earth approach to honestly reflect people's common experiences. A. suggesting that all realist literature questions society and what it means to be an American B. explaining how realism portrayed the brutal realities of war C. defining American society and offering examples of down-to-earth lives D. explaining the aftermath of the Civil War and how realism was a response to a changed world​

Answers

The section explains how realistic depictions of the horrific reality of battle were made. Option (B) is the proper response as a result.

What is realism?

A literary, musical, and artistic movement known as "American Realism" portrayed contemporary socioeconomic realities as well as the daily lives and routines of common people.

The movement got its start in literature in the middle of the 19th century, and by the early 20th century it had become a significant trend in visual art. American realist artwork made an effort to establish what was real, whether it was a cultural depiction or a picturesque vista of downtown New York City.

Hence, option (B) is accurate.

Learn more about realism, from:

brainly.com/question/2832348

#SPJ1

pls help me im bad in reading !!!

Answers

Answer: :\ i cant see that

Explanation:

Focus Assignment
1. Describe two learning activities you might employ that could help transfer Josh's ability
to focus on digital media to other activities. Describe one activity designed to help Josh
develop a sense of trust and safety when engaging in play with other students. Observe
and record the content that Josh favors. What activities/materials could these interests
be transferred to? Observe and record the situations where Josh shows a lack of trust
and a concern for safety.

Answers

Answer:

Two learning activities that could help transfer Josh's ability to focus on digital media to other activities include:

1. Visualization: Have Josh close his eyes and imagine himself in a situation where he is enjoying an activity that does not involve digital media. Have him imagine the sights, sounds, and feelings associated with the activity. Ask him to focus on the details and to describe what he is seeing, hearing, and feeling.

2. Role Playing: Set up a situation in which Josh is interacting with another person or group of people. Ask him to imagine himself in the situation and to act out how he would respond to different scenarios. This can help him develop a sense of trust and safety when engaging in play with other students.

To help Josh develop a sense of trust and safety when engaging in play with other students, have him engage in activities that involve cooperative play. This could include games that require working together to complete a task or solving a problem. Additionally, have him practice activities that involve taking turns and sharing materials.

Observing and recording the content that Josh favors can help to identify activities and materials that his interests can be transferred to. For example, if Josh enjoys watching certain types of videos, he may be interested in creating his own videos or participating in activities that involve video production.

Observing and recording the situations where Josh shows a lack of trust and a concern for safety can help to identify the triggers that lead to these feelings. Once these triggers are identified, strategies can be developed to help Josh manage his feelings in these situations.

Explanation:

for the 3rd grade by "Hello English", Prosveta
1. Listen
and draw lines
Donald
Doris
Click to listen
Dora
Hilda
Robert
Vivian
Trevor
2. Match
1. Marina is
2. Billy
3. I
4. The children
5. My friends are
1.C 2.0 3.0
a) are making a snowman.
b) am doing my homework.
c) writing a postcard.
d) watching TV.
e) is playing football.
5.
3. Fill in
reading, having, wearing, drinking, helping, running, watching
juice?
1. My sister and brother are
books
2. John's dog is
in the garden now
3. Are you
4. The kids are
dinner.
5. Mary is her mother
6. Is Sam
hus oganre jumper today?
7. Tim is video now.
4. Look and write
a Model:
What is she doing?
She is playing tennis.
What are they doing?
They are skiing.
5. Answer:
Model: Are you watching TV now? - Yes, I am., No, I'm not
1. Are you wearing puuple socks today?-
Is your teacher wearing sunglasses now?-
Are you sitting on a chair now?
Are the girls in your class singing now?
HD

Answers

Answer:

this is really confusing. please simplify and clarify

He got up, fetched a can from the porch, and began to water the flowers. "Twice a day regular in the hot weather," he said, "and then the heat sometimes gets the better of the delicate ones. And ferns, good Lord! they could never stand it. Where do you live?"

Why did the author include this paragraph?

Answers

I have had what I believe to be the most remarkable day in my life, and while the events are still fresh in my mind, I wish to put them down on paper as clearly as possible.

What is August heat?

My only near relative, a sister, died five years ago, so that I am independent. I breakfasted this morning at nine, and after glancing through the morning paper I lighted my pipe and proceeded to let my mind wander in the hope that I might chance upon some subject for my pencil.

The room, though door and windows were open, was oppressively hot, and I had just made up my mind that the coolest and most comfortable place in the neighbourhood would be the deep end of the public swimming bath, when the idea came.

So intent was I on my work that I left my lunch untouched, only stopping work when the clock of St. Jude's struck four. The final result, for a hurried sketch, was, I felt sure, the best thing I had done.

Therefore, I have had what I believe to be the most remarkable day in my life, and while the events are still fresh in my mind, I wish to put them down on paper as clearly as possible.

To learn more about Lord, refer to the link:

https://brainly.com/question/1417543

#SPJ1

a friend of yours confided in you that he intends to Dropout of school to get married write a letter to her giving her at least three reasons why she need to stay at school (write in essay form)​

Answers

I believe you should continue your education since, when you're older, a solid education will be necessary for you to find employment. Another factor is that getting married will be unfamiliar to you and may put a lot of pressure on you.

What guidance would you offer to someone considering leaving high school?

Consult the school. Make an appointment to speak with your teen's guidance counselor. Most high schools actually provide a range of assistance options for students who are having trouble, like online courses.

What should be done to stop dropouts?

Make contact with parents outside of the classroom. Connect with the students who are most at danger. Get students involved in extracurricular activities. Advisors and pupils are paired.

To know more about education visit :-

https://brainly.com/question/1602018

#SPJ1

Help I don’t get this

Answers

1) It does not say some men, but it says all men

2) it does not say all white men, but it says all men which includes black men

3) it does not say all gentiles, but it says all men, which includes jews.

4) it does not say all protestants, but it says all men, which includes catholics



what are your advices to the government and communities​

Answers

Answer:

Do not corrupt,and do thier job.

two uses of Starch to the body​

Answers

source of energy

provides nutrients in our diet

When did the harlem renaissance begin and end?

Answers

1920’s - 1930’s i believe is the correct answer
It either ended 1920s or 1930s

Helppp nowww plsssss!!

Answers

Answer:

D is the correct answer to the question

AnswerNGl i just did this in class i believe its A

Explanation:

ANYTHING HELPS!!!!!!!!!!

Answers

Answer:

1. Don't judge a book by its cover

Contradictory Adage: The clothes make the man.

Adage most true, and why?: "Don't judge a book by its cover" is the most true here. This is because judging a man by his physical appearance can lead to misjudgment of who the man truly is. It is not the outside (the cover) that actually makes or defines a man. It is his what is inside that truly defines a man.

2. Curiosity killed the cat

Contradictory Adage: What you don't know can't hurt you

Adage most true, and why?: "Curiosity killed the cat" is the most true here. This is true because being too inquisitive on matters that one doesn't know about can actually expose that individual to danger. The contradictory adage isn't so true because it doesn't really work like that in all cases.

3. Opposites attract

Contradictory Adage: Birds of a feather flock together

Adage most true, and why?: "Opposites attract" is the most true here. This is true because this particular adage actually plays out very well in our world today. It has been designed for opposites to attract. Among humans and animals, opposite genders attract each other. In magnetism, opposite poles attract each.

4. Don't cross that bridge until you come to it

Contradictory Adage: Never put off until tomorrow what you can do today

Adage most true, and why?: "Don't cross that bridge until you come to it" is the most true here. This is because worrying about tomorrow's problems today is needless. They can actually make one to loose focus.

Explanation:

I have been able to answer the given questions.

The main adages in the first column are actually the adages that are most true. In my above explanations, I gave clear explanations why they are the most true.

Proverbs are known to be simple traditional statements that actually express perceived truth and which is usually based on experience or common sense. They can be metaphorical.

Which phrase provides a contrast to the uniformity of the neighborhood?


A “the roofs all display / the same slant of avoidance”


B “a splash of paint on brick surprising as a bruise”


C “a plastic hose poised in a vicious / coil”


D “the too-fixed stare of the wide windows”

Answers

Answer:

B

Explanation:

This phrase describes something that stands out and is unexpected in the neighborhood.

THE PRINCE AND THE PAUPER

The people of London___________In the news of the birth of their new prince.

a. lament
b. dread
C. revel

Answers

Answer:

C. revel

Explanation:

A sentence can be defined as a group of words that comprises of both a subject and predicate used to convey a logical information. Sentences are classified into four (4) main categories and these includes;

I. Simple sentence.

II. Compound sentence.

III. Complex sentence.

IV. Compound-Complex sentence.

Sentences are classified into four (4) main categories based on their functions and these includes;

a. Declarative sentence.

b. Imperative sentence.

c. Exclamatory sentence.

d. Interrogative sentence.

In English language, revel is a word that is used to describe the act of celebration or an instance of happiness, joy, merrymaking by a person.

Hence, the appropriate word to use to describe the reaction of the people of London with respect to the birth of their new prince.

Therefore, the people of London revel in the news of the birth of their new prince.

Please answer this correctly without making mistakes

Answers

the answer to the question is had.
The answer to the question is had

Question 1 of 5 Which sentence contains a subordinating conjunction? O A. I will teach you the laws to follow, and you will obey them or else B. The trees have been cut down; consequently, the soil is eroding. C. Due to his excellent skills, Walter is now considered a master. 0 D. The monkey stole the man's phone while the sloth distracted him.​

Answers

Answer:

I think it is D. The monkey stole the man's phone while the sloth distracted him.​ But not 100%

Explanation:

whats the answer. i need to know

Answers

Answer: I’d say D

Explanation:

I would need more context tone 100% but based on these three paragraphs the point of view seems to stay the same throughout.


hope this helps


II Add Punctuation marks at the end of the
Sentence and write whether they are
declarative
intenrogative, imperative or exclamatory
1. What is the time-
2. This is the
read so far-
most interesting book I have
3. Watch out
4. Could you please repeat the question-
5 Please pass me the salt-
6. Check the tyres before
you
drive off-​

Answers

Answer:

1. What is the time? - interrogative

2. This is the most interesting book I have read so far. - declarative

3. Watch out! - exclamatory

4. Could you please repeat the question? - interrogative

5. Please pass me the salt. - imperative

6. Check the tyres before you drive off. - imperative

Explanation:

A declarative sentence, usually punctuated with a period ( . ), states a fact, offers an explanation, or conveys information.

An interrogative sentence asks a question. It is punctuated with a question mark ( ? ).

An imperative sentence can be punctuated with a period or an exclamation mark ( ! ). It conveys a request, a command, an order, or a suggestions.

Finally, an exclamatory sentence emphasizes something or simply conveys a strong emotion. It is punctuated with an exclamation mark.

by
10. The flashlight should be
Part II. Rewrite the following sentences, adding appositive phrases as specified in parenthesis. Punctuate the
appositive phrases used and underline them. (Note: You can add appositives after any noun in the sentence.)
Example: The girls went to the park. (Begin your appositive with a negation.)
Answers: The girls, not the boys, went to the park.
or
The girls went to the park, not the museum.
11. Tom turned the car to the left. (Begin your appositive with a negation.)
12. The smugglers took the contaminated fish to market. (Begin your appositive with the word "fish.")
13. The pilot ate his dessert while he was piloting the plane. (Begin your appositive with the
"something.")
14. The students entered the talent show. (Begin your appositive with the connective word “especially.”)
15. The woman drank tea before sleeping. (Begin your appositive with the word "tea.")
16. The boys choose to go watch action movies. (Begin your appositive with the negation "never.")
17. Doughnuts are often high in fat. (Begin your appositive with the pronoun "the kind.")
18. The dinner was given by the people at the church. (Begin your appositive with the connective "mainly.")
pronoun

Answers

Answer: Tom turned the car to the left, not to the right

Explanation:

Based on the following reactions who many not have been listening to your thoughts on recycling?
A. "These are some great ideas. We should try to get more towns to follow this plan."
B. "I did not understand your idea about adding more recycling pick up days. Can you explain that again?"
C. "That's good."
D. "You have some good ideas, but remember, not all plastics can be recycled."

Answers

Answer:

ufiyfguhulkvhgjgcuyguifo

Explanatjkkgkion:

iyfyfitifdtuffutuftiufygyuyyguyuyycguyh

A is the answer

Hope this helps :)

Question 2(Multiple Choice Worth 2 points)
(05.01 LC)
Using your knowledge of Aristotle's Rhetorical Triangle, which part would best help you to select your tone?
O Audience
O Pacing
O Purpose
O Speaker

Answers

Use the Rhetorical Triangle to give your message weight and effect. To discover how to balance the crucial components of logos, ethos, and pathos, see our worked example.

What does Aristotle's rhetorical triangle entail?

According to Aristotle, a speaker's capacity to persuade an audience was based on their capacity to establish connections with that audience on the logos, ethos, and pathos levels. These appeals work together to create the rhetorical triangle, so-called by later rhetoricians.

What is the rhetorical triangle's function?

When you consider the three components of the Rhetorical Triangle, you are better equipped to organize your ideas so that your reader (or listener) can understand and concur with them. Spend some time studying rhetoric so that your communications have more power, force, and impact.

To know more about Rhetorical Triangle visit:-

https://brainly.com/question/1011063

#SPJ1

[BRUTUS.] And to speak truth of Caesar,
I have not known when his affections swayed
More than his reason. But 'tis a common proof
That lowliness is young ambition’s ladder,
Whereto the climber-upward turns his face;
But when he once attains the upmost round,
He then unto the ladder turns his back,
Looks in the clouds, scorning the base degrees
By which he did ascend. So Caesar may.
Then lest he may, prevent. And since the quarrel
Will bear no colour for the thing he is,
Fashion it thus: that what he is, augmented,
Would run to these and these extremities;
And therefore think him as a serpent’s egg
Which, hatched, would as his kind grow mischievous,
And kill him in the shell.

Which piece of evidence best supports the theme that power can corrupt people?

"lowliness is young ambition's ladder, / Whereto the climber-upward turns his face"
"scorning the base degrees / By which he did ascend"
"I have not known when his affections swayed / More than his reason"
"the quarrel / Will bear no colour for the thing he is"

Answers

Answer: scorning the base degrees / By which he did ascend"

Explanation:

The piece of evidence best supports the theme that power can corrupt people is "scorning the base degrees / By which he did ascend".

When people attain power, most tend to forget their root and the people who helped them when they didn't have the power. They tend to become proud and not as humble as they were before. This is illustrated in the passage as scorning the base degrees by which he ascend.

The correct option is B.

During prereading, it is not important to pay attention to visual aids.

Answers

Answer:

i feel that it is important

Explanation:

because you might miss something important within them or it will better help you understand.

PLS HELP ASAP!!! Q91 1984: Why does Winston write in large, “clumsy” capitals?


Select one:

a. He is purposefully trying to disguise his handwriting.

b. His handwriting is another example of something that all Oceanians have in common.

c. He wants his handwriting to be a symbol of his silly, clumsy mood.

d. He is in an emotional state of mind and does not write things by hand very often.

Answers

Based on the given narration, the reason why Winston writes in large, “clumsy” capitals is d. He is in an emotional state of mind and does not write things by hand very often.

What is a Narration?

This refers to the term that is used to describe and define the telling of a story with the aid of a narrator where the sequence of a story is displayed.

Hence, it can be seen that the given narration talks about Winston writing in a clumsy way after he felt defeated by the Party hence option D is right and this is because he is in an unstable emotional state which makes him write in capital letters.

Read more about narration here:

https://brainly.com/question/1934766

#SPJ1

How does preparing for and participating effectively in a range of conversations and collaborations with different people prepare you for your future?

Answers

Answer:

Preparing for and participating effectively in a range of conversations and collaborations with different people prepares people for their future because this allows people to interact with their peers, acquiring knowledge through the transmission of specific knowledge and experiences, and finally through the socialization of people with their peers.

In other words, through collaborations and conversations with third parties, people create social ties through which certain experiences are transmitted that allow the person to unconsciously prepare for an eventual future in which such knowledge is necessary.

How does this legal document from 1670 to illustrate the role of the Christian religion in the early new England colonies?

Answers

Answer:

This legal document from 1670 illustrates the role of the Christian religion in the early new England colonies by stating that all laws must be in accordance with the teachings of the Christian religion. It also states that all citizens must adhere to the laws of Christianity and that any violation of these laws will be subject to punishment. Additionally, the document states that all citizens must attend church on Sundays and must not engage in any activities that are considered to be sinful. This document serves as a reminder of the importance of the Christian religion in the early new England colonies and the power it had over the citizens.

Explanation:

A synonym for the word cynical is
O compassionate
O violent
O neutral
O pessimistic
O optimistic

Answers

Answer:

pessimistic

Explanation:

Other Questions
Select the correct answer. Which graph represents the solutions to this equation? x2 + 8x = -20 A. Linear-quadratic system graph shows upward parabola with vertex at (minus 2, 4) and passing through x and y-axis (minus 8, 0), and (0, 0) B. Linear-quadratic system graph shows upward parabola with vertex at (minus 4, 4) and passing through (minus 2, 8), and (minus 6, 8) C. Linear-quadratic system graph shows upward parabola with vertex at (4, 0) and passing through (1, 4), and (6, 4) D. Linear-quadratic system graph shows a downward parabola with vertex at (0, 8) which intercepts the x-axis at 3 and minus 3 units. Lila swam 50 meters north in 10 seconds. Find Lila's velocity TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets. True/False: Money is more important than finding something you're going to lovedoing. Select the correct answer.Which of these is an example of elemental carbon?A. DiamondB. MethaneC. Proteins 6 less than 3 times a number 42 what is the number Two numbers total 31 and have a difference of 9. Find the two numbers. Can someone help me with this question? Can someone please help me with math. The process by which keys are managed by a third party, such as a trusted CA, is known as?O Key escrowO Key destructionO Key renewalO Key management Which sentence best states the central idea of the account?A After the Civil War, the city of San Antonio prospered.B San Antonio is famous because of the Alamo.C Market Square is a large Mexican marketplace in San Antonio.D San Antonio is a thriving city with a fascinating history. Name the minor arcs in the circle Select all the minor arcs by their correct names. (a+b+c)(a-b+c)=a2+b2+c2 prove A nurse is caring for a patient with SIADH. What severe complication should the nurse assess for?a.Strokeb.Diabetes insipidusc.Neurologic damaged.Renal failure Find the measure of angle A, Find the error with subject-verb agreement. Select the incorrect verb and type it correctly.In Chile's arid Atacama Desert there is areas where any rainfall has yet to berecorded Una onda sonora se produce durante 1,5 s. Posee una longitud de onda de 2,4 m y una velocidad de 340 m/s. a) Cul es la frecuencia de la onda?, Ezra has a hard time sticking with exercise routines. He does well for a few weeks, but then tends to slack off a bit. What would be the BEST way for Ezra to motivate himself to stay on the program that he creates for himself? Read the excerpt from "This World is not Conclusion by Emily Dickinson.This World is not Conclusion.A Species stands beyond -Invisible, as Music -But positive, as Sound -It beckons, and it baffles -Philosophy, dont know -And through a Riddle, at the last -Sagacity*, must go.*the quality of being perceptiveWhich statement best describes how capital letters add to the poems overall meaning?They emphasize ideas that cannot easily be understood.They highlight things the speaker would like to do.They suggest that the speaker often overthinks problems.They explain why the world will continue forever. What is the domain of 1 x?