What was the relationship between Vietnam and the United States prior to the Vietnam War?
A. extremely positive
B. warm & fuzzy
C. very complex
D. extremely negative

Answers

Answer 1

Answer:

A

Explanation:

Answer 2

Answer:

B

Explanation:


Related Questions

what were contributions cleisthenes or solon made to the development of athens?

Answers

Cleisthenes introduced democratic reforms to Athens, while Solon is credited with laying the foundations for Athenian democracy.

Cleisthenes is considered the father of Athenian democracy for introducing a series of political reforms that empowered the common people and weakened the power of the aristocracy. He reorganized the political system into ten tribes, each composed of smaller demes or local communities. He also established the Council of Five Hundred, a body of citizens chosen by lot to serve as an advisory council to the Athenian assembly.

Solon, on the other hand, is credited with laying the foundations for Athenian democracy by introducing a number of reforms, such as the abolition of debt slavery and the creation of four classes based on wealth rather than birth, which allowed common people to participate in government. He also established the Athenian assembly, which gave citizens a voice in the political process.

Learn more about Cleisthenes https://brainly.com/question/14095883

#SPJ11

How did the Battle of Marathon affect Greece's development?

E.g captives from other nations became slaves to build boats, which helped increase trade in Egypt. ​

Answers

Answer: The ‘Clash’ At Marathon Shaped Greece, And The West Military historian Jim Lacey says the battle of Marathon, where the vastly outnumbered Greeks defeated the Persian army, had a profound impact on Western civilization, and opened an East-West political and cultural divide that shaped the ancient and modern worlds.

Explanation:Despite the death of their commander, the Greeks had won a stunning victory for very minor losses. Marathon did not end the wars against Persia, but was the first turning point in establishing the success of the Greek, and specifically Athenian way, which would eventually give rise to all western culture as we know it.  I think this the answer not too sure but i thought i'd give it a try:)

Taylor called this approach  blank blank blank

Answers

Taylor's own names for his approach initially included "shop management" and "process management". However, "scientific management" came to national attention in 1910 when crusading attorney Louis Brandeis (then not yet Supreme Court justice) popularized the term.

¿Qué elementos naturales del ambiente se necesitan para actividades como la ganadería y la agricultura?

Answers

Both agriculture and livestock farming rely on several natural elements of the environment to carry out their activities successfully. Some of the most important elements are:

Soil: Soil is the physical support where most agricultural and livestock activities take place. The soil must have the necessary nutrients to grow crops or provide pasture for livestock.Water: Water is essential for plant growth, and it is also needed to keep livestock hydrated. In agriculture, irrigation systems are used to supply water to crops, while in livestock farming, animals need access to clean and fresh water.Sunlight: Sunlight is crucial for photosynthesis, which is the process that plants use to produce energy and grow. Livestock also benefit from sunlight, as it helps to warm their bodies and provides Vitamin D.Air: Air circulation is important for plant growth and prevents the development of certain diseases. In livestock farming, fresh air is necessary to maintain healthy living conditions for the animals.

To learn more about agriculture  click the link below:

brainly.com/question/28312266

#SPJ4

1. Why do you think the founders of the constitution did not allow a president to serve for 20 years? Explain using detailed sentences.
2. Do you think 8 years is enough years to serve as President or are 8 years too many years to serve as president? Describe what you think using detailed sentences.
3. There are only 3 requirements to become president. Do you think there should be more requirements? If yes, what requirements would you add, and explain why? If not, explain why 3 requirements are not enough.
4. The president can veto or dismiss bills/laws the congress was to approve. Do you think the president should have this type of power? Why or why not, Explain.
5. The president has a very difficult job when it comes to running the country. Would you ever want to be the president of the United States? Yes or No. Please explain in detail 3 reasons why you would or would not want to be president of the United States. (3 -5 sentences)
6. If you were president, describe 2 problems you would fix in the United States. Explain why you would fix them using detailed information.

Answers

In presidential and semi-presidential systems, term limits function as a method of limiting the prospect for monopoly, when a leader essentially becomes "president for life". This is to prevent a republic from becoming a de facto tyranny.

Can you serve in the same position for more than eight years?

Section 1. No person may be elected to the office of President more than twice, and no person who has held the office of President for more than two years of a term for which another person was elected President may be elected to the post of President once more.

What three conditions must you satisfy to be elected president?

According to the Constitution, the President must meet three criteria: be at least 35 years old, be a natural-born citizen of the United States, and have lived in the nation for at least 14 years.

Why would the president be able to reject a bill?

The President has the power to veto actions passed by Congress, which was included in the Constitution to prevent the legislative branch from becoming unduly powerful. This serves as an illustration of the principle of the separation of powers that underpins the US Constitution.

What are the two characteristics that, in your opinion, a president must have in order to succeed?

According to a well-known research on presidential character, successful U.S. presidents appear to possess the following leadership qualities: a compelling picture of the country's future. a historical perspective on their own time period. powerful communication skills.

What would you do if you were president to reform the government?

Give forgiveness. suggest nominees for the Supreme Court, the Cabinet, and other powerful positions. designate ambassadors. Discuss issues with the folks in person.

Learn more about leadership qualities: https://brainly.com/question/18498033

#SPJ1

private funding types of contributions for political campaigns

Answers

Some campaigns are partially financed by taxpayers who send $3 to the Presidential Election Campaign Fund when filing their tax returns. Candidates must consent to spending and funding limits in order to be considered for these funds.

Individual political contributions account for a sizable portion of campaign funding: According to the Center for Responsive Politics, individual donations accounted for 71% of Hillary Clinton's fundraising total and 40% of Donald Trump's during the 2016 election campaign. Here are five truths about private election donations.

Campaigns may collect money from individuals, political party committees, and political action committees in general. (PACs). Corporations, labor organizations, and membership organizations are not permitted to donate directly to congressional elections. They can, however, affect federal elections by mobilizing political actionPACs are acronyms for Political Action Committees.

The majority of nations in the globe provide public money to political parties and/or candidates. As convincing as the preceding reasons may appear, there are several excellent arguments for public funding.

Several states refused to ratify the Constitution unless:

Amendment 1 was added

The Bill of Rights was added

The Magna Carta was added

The Judiciary was removed

Answers

hope this helps. btw i need brainliest to level up

the answer is b) the bill of rights was added

explanation: many states and anti federalists feared that the new national government would be too powerful and thus threaten individual liberties, given the absence of a bill of rights. so they refused to ratify unless they had written and approved laws guaranteeing personal rights and freedoms.

based on this excerpt, the mayflower compact contributed to the establishment of which idea in the colonies?

Answers

The Mayflower Compact is historically significant because it represents one of the first attempts at self-government in what would later become the United States.

The compact was signed by 41 male passengers aboard the Mayflower, which arrived at present-day Plymouth, Massachusetts, in November 1620. The document established a civil government and a basic legal system for the Plymouth Colony.

The Mayflower Compact is seen as an early expression of the democratic ideals that would later form the foundation of the United States. It established the principle that government should be based on the consent of the governed and that people have the right to participate in the governing process. The compact also recognized the importance of written laws and the need for a social contract between the government and the governed.

To learn more about mayflower visit;

https://brainly.com/question/6216725

#SPJ4

Correct question:

What's the importance of the Mayflower Compact?

which class played a key role in resisting colonial rule in southeast asia?

Answers

The middle class played a key role in resisting colonial rule in Southeast Asia.

The middle class in Southeast Asia consisted of educated professionals such as teachers, lawyers, and journalists who were exposed to Western ideas and values. They were able to organize and mobilize resistance movements against colonial powers such as Britain, France, and the Netherlands.

The middle class played a pivotal role in developing nationalistic movements and advocating for independence from colonial rule. They were often the ones who formed political parties and led protests and strikes against colonial powers. The middle class also played a key role in negotiating with colonial powers for independence and establishing new governments after independence was achieved.

Learn more about colonial rule

https://brainly.com/question/1218824

#SPJ4

How many Amendments did James Madison originally have?

A 15
B 16
C17
D 18

Answers

James Madison originally proposed 12 amendments to the Constitution in 1789.

why did large numbers fof hindus and muslims migrate immediately after indian gained its independence

Answers

In the wake of Partition, Hindus in Pakistan felt threatened by their Muslim neighbors and decided to migrate to India, while Muslims in India felt that they would be safer in the newly formed Pakistan.


After India gained independence in 1947, Hindu-Muslim riots led to large-scale migration of Hindus and Muslims between India and Pakistan. Hindus and Muslims had been living together for centuries, but the Partition of India and the creation of the new nation of Pakistan, with its majority Muslim population, resulted in deep divisions among the two religions. This led to violence and displacement of people on a massive scale.

Apart from the religious divide, other factors such as poverty and fear of violence also led to the migration. People from the lower economic strata, unable to cope with the upheaval caused by Partition, chose to move to a different nation, hoping for a better life.

The Partition of India, and the resulting large-scale migration of Hindus and Muslims, is a defining moment in the history of India. It caused deep-rooted divisions among the two religions and had far-reaching consequences for both countries.

Know more about Partition here:

https://brainly.com/question/12053603

#SPJ11

In 1838, there were Cherokee who defended and refused to leave their land. What was President Van Buren's
response to this?
O He extended the deadline for them to leave.
• He ordered the Army to remove them by force.
O He ordered negotiation of a new treaty.
• He canceled the plans for relocation. Answer is B

Answers

Answer: The Cherokee government protested the legality of the treaty until 1838, when U.S. president Martin Van Buren ordered the U.S. Army into the Cherokee Nation. The soldiers rounded up as many Cherokees as they could into temporary stockades and subsequently marched the captives, led by John Ross, to the Indian Territory.

Explanation:

B. is the correct answer



1. Compare the air pressure of A, B, C and D. What do you notice?
2. Location is within the eye of the tropical cyclone. Location F is within the
clouds surrounding the eye. The clouds at make up the eye wall. The wind
speeds at the two locations are:​

Answers

Without specific wind speed data for locations F and within the eye of the tropical cyclone, it is not possible to provide a comparison between the two locations.

However, it is generally known that the eye of a tropical cyclone is an area of relatively calm weather with light winds and clear skies, while the eye wall surrounding the eye is an area of intense thunderstorms and the highest wind speeds in the entire storm. As the eye wall can cause the most significant damage and destruction during a tropical cyclone, it is crucial to monitor wind speeds and take necessary safety precautions. Therefore, if location F is within the clouds surrounding the eye, it may still be experiencing strong winds and heavy rainfall, although the conditions are likely to be less severe than those at the eye wall.

To learn more about cyclone click the link below:

brainly.com/question/29433190

#SPJ4

CHAPTER 9
LEARNING THE SKILL
Historians use graphs and charts to display statistical data that they have collected. A bar
graph uses the length of horizontal or vertical bars to show actual values or percentages of
the whole. Bar graphs can be used to show multiple sets of data.
PRACTICING THE SKILL
DIRECTIONS: Refer to the bar graph comparing the strength of the North and South on page
315 of your text. Then answer the following questions on a separate sheet of paper.
Resources of the Union and of the Confederacy
100
90
80
70
0
60
50
40
30
20
10
90%
72%
56%
44%
baldin
28%
10%
71%
2990
92%
8%
Population Manufactured Exports Merchant Miles of
goods
Source: Historical Statistics of the United States
Union Confederacy
69%
31%
Grain
ships railroad track production
67%
33%
95%
Iron
Number of
farms production
82%
18%
Banking
capital
1. What information does the graph provide about the resources of the two sides in this
conflict?

Answers

The graph provides information about various resources of the Union and the Confederacy during the conflict.

What transpired between the Union and the Confederacy during the conflict?

The conflict referred to in this context is likely the American Civil War (1861-1865), which was fought between the Union (also known as the United States) and the Confederacy (also known as the Confederate States of America).

During the Civil War, the Union and the Confederacy were engaged in a military and political struggle for control over the country. The Confederacy, which consisted of 11 southern states that had seceded from the Union, sought to maintain their way of life, which was based on slavery and agriculture. The Union, on the other hand, sought to preserve the unity of the country and end the practice of slavery.

The conflict resulted in numerous battles and campaigns, with both sides winning victories and suffering defeats. Ultimately, the Union emerged victorious, and the Confederacy surrendered in 1865. The war had a profound impact on the country, resulting in the abolition of slavery, the reunification of the nation, and the deaths of hundreds of thousands of people

The graph shows the percentage of population, manufactured goods, exports, merchant ships, miles of railroad track, grain production, iron production, number of farms, and banking capital that each side had. The graph also shows the percentage of the total resources held by each side.

learn more about Confederacy: https://brainly.com/question/951920

#SPJ1

What happen as a result of the Freedmen’s Bureau’s failure to boost landownership among Black Americans in the South?
A. Most formerly enslaved people migrated to the North.
B. The system of sharecropping developed.
C. Republicans lost support among Black voters.
D. Slavery reemerged as an institution.

Answers

B. The system of sharecropping developed.

What is one example of the separation of powers?

Political issues can be decided through popular vote.
People and groups are required to obey the law at all times.
The federal government is made up of three branches.
Some laws are national and apply to all of the states.

Answers

The answer is, C. The federal government is made up of three branches. This is one of the example of the separation of powers.

The tripartite system used in the United States and the United Kingdom, which has three distinct departments of government (the executive branch, the legislative branch, and the judicial branch), is the most well-known illustration of the separation of powers.

Hence, the correct answer is C. The federal government is made up of three branches.

Government?

A government is an organization or a system made up of a number of individuals who look after or administer a nation or a state.

Every government has a constitution or set of guiding principles that it adheres to in order to provide efficient government.

To know more on Government visit:

https://brainly.com/question/16940043

#SPJ1

why did the outer party members like winston suffer more surveillance and propaganda than the more numerous proles?

Answers

The outer party members, like Winston, were subjected to more surveillance and propaganda than the proles because they posed a greater threat to the government's power and control.

The government was aware that the outer party members had access to education, higher-thinking, and privilege, and therefore could potentially be swayed by any subversive ideals.

Thus, the government sought to keep a watchful eye on them through increased surveillance and used propaganda to encourage them to remain loyal and support the Party's ideals.

Furthermore, the government also sought to deny the outer party members the privilege of advancement, which they could use to overthrow the Party. To do this, the Party enforced strict rules that prohibited any sort of progress or privilege for the outer party members.

To know more about subversive click on below link:

https://brainly.com/question/2873149#

#SPJ11

Designing a divination method worksheet answers key questions. 1. What will your method be?
2. What three questions will you ask?
3. Where are your answers coming from?
4. Who has access to this process?
5. Does this process give legitimacy to any group or person in your imagined society?

Answers

The method can be tarot cards, astrology, runes, tea leaves, pendulum, etc. It depends on personal preference or cultural traditions.The questions can be related to different aspects of life, such as love, career, health, or spiritual guidance. For example, "What should I focus on in my career?" "What can I do to improve my health?" "What is my purpose in life?"The answers are believed to come from a higher power, spirits, ancestors, or the subconscious mind of the person performing the divination. The method is a tool for tapping into that source of knowledge.Anyone who has access to the method and knows how to use it can perform divination. It can be an individual or a group of people, such as a spiritual community or a professional diviner.In some societies, certain groups or individuals may have more authority or legitimacy in performing divination, such as religious leaders or elders. However, it ultimately depends on the beliefs and values of the community using the method.

excavation in northern montana (with help from the blackfoot tribe) found evidence of a hunting practice used for thousands of years in. this site was a:

Answers

Excavation in northern Montana (with help from the Blackfoot tribe) found evidence of a hunting practice used for thousands of years in a site that was a: hunting ground.

What is excavation?

Excavation is the methodical and scientific excavation of archaeological sites or finds to uncover and record the physical and cultural features that reveal the human past. Excavation may be the initial stage of archaeological research, but it is not synonymous with the study of archaeology.

Learn more about excavation at

https://brainly.com/question/27447995

#SPJ11

what ideology had the greatest impact on incentivizing fighting during world war i? group of answer choices socialism colonialism nationalism republicanism humanism

Answers

The ideology had the greatest impact on incentivizing fighting during world war I nationalism.

How contributed nationalism to the start of the European War?

Because it encouraged nations to increase their power in Europe, nationalism is to blame for the current situation. Amongst the great European powers, this led to conflict. As an illustration, in the years leading up to World War I, there was a fierce naval and weapons race among various European countries.

What effects did the 17th Amendment's adoption have?

Direct elections for U.S. senators in each state were established by the 17th Amendment (Amendment XVII) to the U.S. Constitution. Senators were previously chosen by state legislatures, but the amendment repeals Clauses 1 and 2 of Article I, Section 3 of the Constitution.

To Know more about Constitution.

https://brainly.com/question/29799909

#SPJ1

True/False? in 1942, billboard began for the first time to list race music and hillbilly music, subsuming them under the single category western and race.

Answers

The given statement " in 1942, billboard began for the first time to list race music and hillbilly music, subsuming them under the single category western and race." is true becasue billboard began for the first time in 1942 to list race music and hillbilly music under the single category of Western and Race.

In 1942, Billboard magazine began to categorize music by race and genre, subsuming "Race music" (African American music) and "Hillbilly music" (country music) under the single category "Western and Race". This categorization continued until the early 1950s, when the term "Rhythm and Blues" was introduced to replace "Race music".

You can learn more about  Billboard magazine at

https://brainly.com/question/20476436

#SPJ11

why did the french withdraw from indochina in the 1950s

Answers

The French withdrew from Indochina in the 1950s due to a combination of political, economic, and military factors.

Ultimately, the French had become embroiled in a costly and lengthy conflict with the Viet Minh, a nationalist movement seeking to end French colonialism and establish an independent Vietnam. The war had weakened the French economy, leading to growing dissatisfaction with the war effort at home.

Furthermore, the Cold War had begun and the United States had become increasingly skeptical of European colonialism and was unwilling to support the French effort. As a result, the French had become increasingly isolated and unwilling to continue the war. In addition, the Viet Minh had become better equipped and increasingly successful in their efforts to drive the French out of Indochina. Ultimately, the French decided to withdraw from Indochina in order to preserve their resources and protect their interests.

To know more about Indochina, click here:

https://brainly.com/question/27935599

#SPJ4

attendance at american colleges and universities between 1899 and 1929 was

Answers

Between 1899 and 1929, the attendance at American colleges and universities increased substantially due to various factors such as the growth of secondary schools, the establishment of new institutions, and a changing economy.

During this period, American higher education underwent significant changes and experienced a shift towards mass higher education. This led to an increase in enrollment, particularly among women and minorities. Women's colleges were also established during this time to cater to the growing demand for higher education among women.American colleges and universities during this period were largely influenced by the principles of the progressive movement, which emphasized social justice, democracy, and individual freedom. This led to an emphasis on practical education and the integration of vocational training into the curriculum.

Many institutions also offered adult education and extension programs to serve the needs of working-class and immigrant communities.The rise of American higher education during this period was also aided by philanthropic organizations, which provided funding for research and the establishment of new institutions. The growth of the economy also led to increased demand for skilled workers, which further fuelled the expansion of higher education. As a result of these various factors, the attendance at American colleges and universities between 1899 and 1929 saw a significant increase, laying the foundation for the mass higher education system that exists in the United States today.

Question: Attendance at American colleges and universities between 1899 and 1929 was influenced by various factors. What were some of the main factors that impacted student enrollment during this time period and what was the impact?

Ton know more about American Colleges:

https://brainly.com/question/821890

#SPJ11

what two groups were brought together in christ in the letter to the galatians?

Answers

In the letter to the Galatians, two groups that were brought together in Christ were Jewish Christians and Gentile Christians.

The Galatians were a group of churches in the region of Galatia, which is in modern-day Turkey. Paul, the author of the letter, had visited these churches on his missionary journeys and had preached the gospel to them. However, after Paul left, some Judaizers (Jewish Christians who insisted on adherence to Jewish customs) came to Galatia and taught that Gentile Christians needed to follow Jewish laws and customs, such as circumcision and dietary restrictions, in order to be saved.

In his letter, Paul argued that salvation comes through faith in Jesus Christ alone and that Gentile Christians did not need to follow Jewish laws and customs in order to be saved. He also emphasized that Jewish and Gentile Christians are united in Christ and that there is no distinction between them. In Galatians 3:28, Paul wrote, "There is neither Jew nor Gentile, neither slave nor free, nor is there male and female, for you are all one in Christ Jesus."

Thus, the letter to the Galatians emphasizes the unity of Jewish and Gentile Christians in Christ and the importance of salvation through faith alone.

Learn more about Galatians,

https://brainly.com/question/7036922

#SPJ4

Read the excerpt and answer the question that follows.
Other industrialists, including John D. Rockefeller, merged the
operations of many large companies to form a trust. Rockefeller's
Standard Oil Trust came to monopolize 90% of the industry. . .
What was one DIRECT effect of the business practice discussed in this excerpt?
Employees were prevented from buying stock.
There was decreased competition among producers.
There was a lack of employment opportunities for immigrants.
Consumers were denied access to goods.

Answers

The business practice discussed in the excerpt refers to the formation of trusts, which were groups of large companies that joined together to create monopolies in their industries. John D. Rockefeller's Standard Oil Trust is a notable example, which controlled 90% of the oil industry in the United States.

The correct option is: "There was decreased competition among producers."

By forming trusts and monopolies, companies were able to control the market and limit competition from other producers. This gave them the power to set prices and control the supply of goods, which often led to higher prices and decreased access to goods for consumers. This practice also limited opportunities for smaller companies to enter the market and compete with larger, established companies.

Thus, the direct effect of this business practice was decreased competition among producers, which allowed trusts like Standard Oil to dominate their industries and control prices and supply. This had a negative impact on consumers and smaller businesses, who were often unable to compete with the power and resources of these large trusts.

Learn more about the monopoly:

brainly.com/question/29765560

#SPJ4

Who was the libertarian candidate for president in 2008?

Answers

Answer: Bob Barr

Explanation:

Barr publicly announced his candidacy on May 12, 2008.

Economic difficulties experienced in Germany between 1923 and 1933 can be linked to the harsh restrictions of the
Fourteen Points.
Treaty of Brest-Litovsk.
Treaty of Versailles.
Mandate System

Answers

Economic difficulties experienced in Germany between 1923 and 1933 can be linked to the harsh restrictions of the Treaty of Versailles.

The Treaty of Versailles was the settlement reached at the end of World War I. This treaty was signed on June 28, 1919, and it was one of the most significant peace treaties in history. The treaty was meant to punish Germany for its role in World War I, and it imposed harsh penalties on the country. The Treaty of Versailles led to economic difficulties in Germany between 1923 and 1933.

Germany was required to pay massive reparations to the Allies, which devastated the country's economy. The reparations were so high that Germany had to print more money to pay them, which led to hyperinflation. The high levels of inflation led to a severe devaluation of the German mark, which made it difficult for people to afford basic goods and services. The economic crisis that followed the Treaty of Versailles led to political instability in Germany. Many Germans felt that the treaty was unjust and that the harsh terms were designed to humiliate their country.

This sense of resentment provided a fertile breeding ground for extremist political parties like the Nazi Party to gain support from disillusioned Germans. In conclusion, the economic difficulties experienced in Germany between 1923 and 1933 can be linked to the harsh restrictions of the Treaty of Versailles. The treaty imposed massive reparations on Germany, which led to hyperinflation and a devaluation of the German mark. The economic crisis that followed the treaty led to political instability, which paved the way for extremist parties like the Nazi Party to gain support.

Know more about Treaty of Versailles here:

https://brainly.com/question/12097202

#SPJ11

more than anything else, what did most american settlers want from american indians? a for them to be religious b for them to dress like europeans/white americans c their farming skills

Answers

i believe the answer is C.

samurai warriors were recruited from group of answer choices the local nobility. common peasants of ability. royal bodyguards. royal family.

Answers

Samurai warriors were recruited from the local nobility group. This group of people used to belong to a unique social class that existed in Japan during the medieval period.

The samurai warriors group can be defined as the military nobility of medieval Japan. They followed a set of rules called the Bushido, which encouraged them to be loyal, brave, honest, and disciplined.

What was the origin of samurai warriors?

The samurai warriors have their origin in Japan, and they first came into being in the 8th century AD. In the medieval era, Japan was divided into several provinces and ruled by individual warlords. These warlords appointed their own military force to maintain law and order in their territories.

However, these forces lacked discipline and proper training. So, during the 10th and 11th centuries, some of these warlords began to form a new class of trained soldiers who would remain loyal to them and serve them in times of need. These trained soldiers were the first samurai warriors.

The recruitment process of samurai warriors- Samurai warriors were recruited from the local nobility group. They were the sons of wealthy landowners or noblemen who could afford to equip them with armor, horses, and weapons.

However, in the later years, when the samurai class grew, the recruitment became more flexible, and commoners were also allowed to become samurai warriors. The samurai warriors were highly trained in martial arts and could wield various weapons such as the katana sword, the bow and arrow, and the spear.

They were trained in different styles of fighting, such as Jujutsu, Kenjutsu, and Kyujutsu, which made them deadly on the battlefield.

To know more about Samurai warriors, click on the link below:

https://brainly.com/question/729453#

#SPJ11

What were the three effects of the decision of the council?


the Jews began to be persecuted
Paul never went on a missionary journey again
Paul's mission was made clearer
the Gentile and Jewish missions could exist side by side
no more preaching was done to the Gentiles

Answers

Answer: Paul's mission was made clearer and

the Gentile and Jewish missions could exist side by side

Explanation:

Other Questions
if a restriction enzyme that recognizes ggcat and cuts between the two guanine residues is mixed with dna that has the sequence ccgattataatcccgcggcatattagggcgg, how many pieces would the resulting product be? which of the following would most directly interfere with sperm production? which of the following would most directly interfere with sperm production? use of synthetic steroids (testosterone) low sperm count interruption of sustentocytes' production of abp ingestion of a substance that mimicked inhibin How did US and Soviet nuclear arsenals compare? Use the equation in the example to find the number ofcups of water you need if you have 12 cups of flour. when carbonyl compounds are reduced with a reagent such as lialh4 or nabh4 and a new stereogenic center is formed, what will the composition of the product mixture be? 7The United States receives more immigrants than any other nation in the world. However, many countries, like Saudi Arabia and Australia, have a greater percentage of their population made up of immigrants. What does this information reveal about these countries? A. They have smaller populations than that of the United States. B. Their life expectancy is less than in the United States. C. They have more lenient immigration policies than those in the United States. D. They encourage immigrants to move there more than the United States does. why is less atp produced by anaerobic respiration than by aerobic respiration? anaerobic respiration does not make use of an electron transport chain. anaerobic respiration uses a final electron acceptor that is less electronegative than o2, which is used as the final electron acceptor in aerobic respiration. anaerobic respiration does not make use of the citric acid cycle. all of these answers are correct. macy does not like a few of the standard operating procedures adapted for the new project. however, she discussed the items with the team and told them that she realized she was in the minority and that she would adapt the new procedures to maintain smooth operations within the team. which conflict-handling mode did macy use? spicy dish, a large distributor of canned beans and salsa, is organized into four business units: (1) north america salsa, (2) north america legume, (3) latin america, and (4) europe and asia. what two types of departmentalization are illustrated in this example? question 8 options: Describe the cities of the Indus River Valley (Use atleast 3 details):3 4. Myron Security, Inc., had total sales for 1 year of $945,860. Their advertising expenses were $57,370. a. Estimate the percent advertising expenses were of total sales. How do u think readers responded to the William Travis letter with this corrective lens in place, what is her new near point? express your answer with the appropriate units. Write an essay of 400-450 words (2-2 pages) on ONE of the following topics. Write downthe NUMBER and TITLE/HEADING of your essay.The goals left behind tony is diagnosed with acid reflux. this is a condition in which stomach secretions which contain hydrochloric acid or hcl, regurgitate (reflux) out of the stomach and into the esophagus. stomach secretions are very acidic with a ph around 2.0. the acids damage the esophagus and it is felt as heartburn. this painful condition can be treated with over-the-counter (otc) antacids. what do you think these antacids are? why are some organizations more efficient and effective at what they do than others? A plan of a school compound is drawn to a scale of 1cm represent 5m. 1 find its length and breadth of the drawing. If the football field is 50m by 30m. 2 if the scale drawing of the hall is 7cm by 32cm rectangle, find its length and breadth The breakdown of lipids and the breakdown o carbohydrates are similar because they both blank energy Find the measure of XY.Y74NX Two of cryus ideas about government explian how these can be an example for leaders of nations today