what was the Weimar Republic?

Answers

Answer 1

Answer:  1933, after the end of World War I and the abdication of Kaiser Wilhelm II. It was named after the city of Weimar, where the new constitution was written and adopted in 1919.

The Weimar Republic was marked by a period of political, social, and economic instability. The government faced significant challenges, including inflation, unemployment, political extremism, and the rise of Adolf Hitler and the Nazi Party. However, during its brief existence, the Weimar Republic made significant strides in social and cultural progress, including the promotion of women's rights, freedom of expression, and the arts.

The Weimar Republic came to an end in 1933 when Adolf Hitler and the Nazi Party seized power and established a dictatorship. The failure of the Weimar Republic to address the challenges it faced paved the way for the rise of the Nazis and the horrors of World War II.

Explanation: can i get brainliest :D


Related Questions

Fenómeno natural que afectaba el comercio marítimo

Answers

The natural phenomenon that affects maritime commerce is known as ocean currents. These are the continuous movements of seawater that are driven by factors such as wind, temperature, and salinity.

Ocean currents can have a significant impact on shipping and trade routes, as they can either help or hinder the movement of ships across the water. For example, some ocean currents can speed up shipping routes, while others can slow them down or even make them impossible to navigate.

Additionally, ocean currents can also affect the distribution and abundance of marine life, which can have further impacts on the fishing industry and seafood trade. Understanding ocean currents and their effects on maritime commerce is important for industries that rely on sea transportation and trade.

To know more about ocean currents visit:

https://brainly.com/question/21654036

#SPJ11

One effect of this invention was that textile factories no longer needed to be located near rivers. another effect was that factories could operate even when a nearby river was frozen over. which invention is described in the information

Answers

The invention described in the information is the steam engine.

Prior to the development of the steam engine, factories were mostly located near rivers because water power was the main source of energy.

The steam engine revolutionized the manufacturing process by providing an alternative source of power that did not depend on the proximity of a river. This allowed factories to be located in cities and towns, closer to markets and sources of labor, rather than being confined to rural areas near water sources. As a result, the steam engine led to the growth of urban areas and the development of modern industrial society.

Another effect of the steam engine was that it allowed factories to operate even when a nearby river was frozen over. This was because the steam engine generated power by burning coal, which was not dependent on the season or weather conditions.

This increased the efficiency and productivity of factories and made it possible for them to operate year-round. The steam engine also had a significant impact on transportation, enabling the development of steamships and locomotives that could transport goods and people over long distances at a faster pace than ever before.

Overall, the steam engine was a critical invention that played a crucial role in the Industrial Revolution and the development of modern society.

To learn more about steam engine refer here:

https://brainly.com/question/30732717

#SPJ11

What do you think are factors that influence an individual's political attitudes and actions in regard to donating to pacs or 527 groups?

Answers

The factors that influence an individual's political attitudes and actions in regard to donating to pacs or 527 groups are political socialization, voting, campaign activities, level of modernization and urbanization.

The most common civic action, particularly in contemporary democracies, is voting. Voting has a significant impact on every member of a society, both in terms of its breadth and its results. Voting determines the party's leadership concerns and policies as well as those of the entire country. The primary criterion, which is usually almost higher than the other indicators, is still voting in elections.

The process through which people learn about topics and ideologies and come to associate with a certain political party is known as political socialization. Both the quantity and the calibre of involvement are impacted. Politically conscious people are typically better at connecting their social values to their political beliefs and creating internal consistency in their thought systems.

To learn more about voting here

brainly.com/question/28904540

#SPJ4

what are the pros and cons of william fallout shelter so that he will be safe in the nuclear war​

Answers

Answer: Pros

Image result for Pros of a nuclear shelter

Much of this highly radioactive material falls to Earth, subjecting anything within the line of sight to radiation, becoming a significant hazard. A fallout shelter is designed to allow its occupants to minimize exposure to harmful fallout until radioactivity has decayed to a safer level.

Cons

Some of the disadvantages of bunkers are high initial investment, filling and packing influence dry matter losses, not cost effective for small herds, labor for sufficient packing and covering of silo is critical, and safety concerns.

Explanation:

the explanation ffor this is well nucleear shelteers have to be nuke proof

Explain how the wwii provided the nazis opportunity to adopt more radical measures against the jews

Answers

World War II provided the Nazis with an opportunity to adopt more radical measures against the Jews for a number of reasons. First, the war created a climate of fear and instability that allowed the Nazis to more easily scapegoat and demonize Jews, blaming them for Germany's problems. Second, the war led to the occupation of many European countries, including Poland, which had a large Jewish population. This gave the Nazis control over more Jews than ever before, and allowed them to implement their "Final Solution" more efficiently. Finally, the war created a sense of urgency and desperation within the Nazi leadership, which may have led them to adopt more radical measures in an attempt to win the war. Overall, the combination of wartime conditions and Nazi ideology created a perfect storm that allowed the Nazis to implement their genocidal policies with devastating effect.

On the debate Harvard, junior touched on the issue of solving civic social issues either by violence or civil disobedience. Which of these two methods or ways would you choose? Give an example using current affair in South Africa of why would you choose it and of why you think it's better than others. I need 2 pages please ​

Answers

The choice between violence and civil disobedience to solve social issues is a complex one that should be considered carefully. In South Africa, civil disobedience has been used to challenge the status quo and bring about positive change. It is a method that respects human rights and can lead to a more inclusive and democratic society.

Regarding the debate on solving civic social issues, it is important to consider the context and specific circumstances of each case. Violence and civil disobedience are two opposing methods that have been used throughout history to achieve social change.

Violence is characterized by the use of force and aggression towards individuals or groups that oppose certain ideals or beliefs. On the other hand, civil disobedience is a peaceful way to protest and challenge the status quo by breaking the law in a nonviolent way.

In South Africa, there have been many instances of both violence and civil disobedience to fight against social issues such as racism and inequality. One current example is the protests against the arrest of former president Jacob Zuma.

Some protestors have resorted to violent methods, such as looting and damaging property, while others have chosen civil disobedience by organizing peaceful marches and sit-ins.

Although violence can sometimes bring about immediate change, it often leads to more violence and harm to innocent people. In contrast, civil disobedience can be more effective in the long run by raising awareness and putting pressure on the government to address social issues.

In my opinion, civil disobedience is a better method to solve social issues because it is a peaceful way to bring about change and it shows respect for human rights. It also creates a dialogue and can lead to a more inclusive and democratic society.

However, it is important to note that civil disobedience should be used responsibly and not put people's safety at risk.

In conclusion, the choice between violence and civil disobedience to solve social issues is a complex one that should be considered carefully. In South Africa, civil disobedience has been used to challenge the status quo and bring about positive change. It is a method that respects human rights and can lead to a more inclusive and democratic society.

To know more about civil disobedience refer here:

https://brainly.com/question/9330788#

#SPJ11

How is the parliamentary system of government different from the presidential system

Answers

The parliamentary system of government and the presidential system are two different forms of democratic government, with distinct structures and powers. Here are some key differences between them:

Executive Power: In a parliamentary system, the executive power is vested in the Prime Minister and the Cabinet, who are members of the parliament. In a presidential system, the executive power is vested in the President who is elected by the people.

Separation of Powers: In a presidential system, there is a clear separation of powers between the executive, legislative, and judicial branches. In a parliamentary system, the executive and legislative branches are often fused, with the parliament having the power to remove the Prime Minister through a vote of no confidence.

Role of the Legislature: In a parliamentary system, the legislature plays a more dominant role, with the Prime Minister and Cabinet being accountable to the parliament. In a presidential system, the President is often more independent from the legislature.

Term of Office: In a parliamentary system, the Prime Minister's term of office depends on the support of the parliament, which can vote to remove him or her at any time. In a presidential system, the President's term of office is fixed, and he or she cannot be removed except through impeachment or resignation.

Electoral System: In a parliamentary system, voters elect members of parliament who then choose the Prime Minister. In a presidential system, voters directly elect the President.

Overall, the main difference between the two systems is that in a parliamentary system, the executive and legislative branches are more closely linked, while in a presidential system they are more separate.

20points please help



Select ALL the correct answers.


Which two arguments support judicial restraint?



It is the job of the court to defer to the policy decisions of the executive branch.



It is the job of the court to consider precedent.



It is the job of the court to consider changing social conditions and values.



It is the job of the court to shape social policy.

Answers

The correct answers are:

It is the job of the court to consider precedent.

It is the job of the court to defer to the policy decisions of the executive branch.

Explanation:

Judicial restraint is a philosophy that advocates for judges to limit their power and defer to the decisions of elected officials whenever possible. It emphasizes the importance of following legal precedent and not making decisions based on personal opinions or political beliefs.

Answer:

It is the job of the court to consider precedent.
It is the job of the court to defer to the policy decisions of the executive branch.

Explanation:

How does the membership of the house of representatives and the senate differ?

Answers

The membership of the House of Representatives and the Senate differs in several ways, including:

Size: The House of Representatives has 435 members, whereas the Senate has 100 members.

Term length: Representatives serve two-year terms, while Senators serve six-year terms.

Constituency: Representatives are elected by the people of their congressional district, while Senators are elected by the people of their entire state.

Qualifications: Representatives must be at least 25 years old, a U.S. citizen for at least seven years, and a resident of the state they represent. Senators must be at least 30 years old, a U.S. citizen for at least nine years, and a resident of the state they represent.

Role: The House of Representatives is responsible for initiating revenue bills and impeachment proceedings, while the Senate has the power to approve or reject presidential nominations, ratify treaties, and hold impeachment trials.

Leadership: The Speaker of the House is the presiding officer of the House of Representatives, while the Vice President of the United States serves as the President of the Senate. However, the Senate also has a President pro tempore who presides in the absence of the Vice President.

Overall, the House of Representatives and the Senate are designed to represent different constituencies and have distinct roles in the legislative process, though they often work together to pass legislation.

this is my answer...

In 2011, after eight years of fighting, american troops returned home from iraq. Their departure, combined with the fragile governments in the outskirts of iraq, gave rise to fundamentalist groups that gained power. Fill in the blanks to complete the passage describing one such group.

Answers

In 2011, after eight years of fighting, American troops returned home from Iraq. Their departure, combined with the fragile governments in the outskirts of Iraq, gave rise to fundamentalist groups that gained power.

In 2011, the United States withdrew its troops from Iraq, marking the end of eight years of war and occupation. The withdrawal of American troops came after a long and costly war that began in 2003 when the US-led coalition invaded Iraq to overthrow Saddam Hussein's regime. The war had a significant impact on Iraq, leading to the death of thousands of Iraqis and US soldiers and causing extensive damage to the country's infrastructure and economy.

However, the departure of American troops from Iraq did not lead to the stability and peace that was expected. Instead, it created a power vacuum that was quickly filled by fundamentalist groups, including the Islamic State of Iraq and Syria (ISIS). These groups were able to gain power by exploiting the fragile governments in the outskirts of Iraq and taking advantage of sectarian divides that had deepened during the war.

-----------The given question is incomplete, the complete question is:

"In 2011, after eight years of fighting, _________ returned home from Iraq. Their departure, combined with the fragile governments in the outskirts of ______, gave rise to ____________ groups that gained power. Fill in the blanks to complete the passage."--------------

To know more about Iraq, click here.

https://brainly.com/question/29605758

#SPJ4

NEED HELP ASAP

1. What is the most striking or interesting part of Henry’s story that you read? Explain. 2. How is Henry’s story an autobiography? What does he tell you about his life before the war?
3. How was Hitler able to gain the support of many German people? What tactics did he use?
4. How was Henry’s family affected by Hitler’s tactics and beliefs?
5. When Henry immigrated to the United States, would he have been considered a migrant or a refugee? Explain your answer.

Answers

1. The most striking part of Henry's story is his experience as a prisoner of war and his escape from the Soviet Union.

2. Henry's story is an autobiography because it is a firsthand account of his own life.

3. Hitler was able to gain the support of many German people through a combination of propaganda, fear, and promises of economic and military prosperity.

4. Henry's family was greatly affected by Hitler's tactics and beliefs.

5. When Henry immigrated to the United States, he would have been considered a migrant, as he chose to leave his home country voluntarily in search of better opportunities.

1. He vividly describes the inhumane treatment and the harsh conditions he endured during his captivity, making it an unforgettable part of his story.

2. He tells the reader about his childhood, his education, his family, and his experiences before, during, and after World War II. He talks about his love of music, his relationships, and his struggles, making it a personal and introspective account of his life.

3. He used rallies, speeches, and media to spread his message, and he blamed Germany's problems on Jews and other minority groups, stirring up hate and nationalism. He also promised to restore Germany's power and prestige, appealing to those who were disillusioned with the Weimar Republic and the Treaty of Versailles.

4. His father lost his job and was forced to work in a factory, his sister was harassed and eventually expelled from school, and his mother suffered from anxiety and depression. Henry himself was conscripted into the army and became a prisoner of war, enduring terrible conditions and risking his life.

5.However, he could also be considered a refugee, as he faced persecution and danger in his home country and had to flee for his safety. The distinction between migrant and refugee can be blurred, and in Henry's case, it is a matter of interpretation and perspective. Regardless of how he is classified, Henry's story is a powerful reminder of the challenges and opportunities that come with starting a new life in a foreign country.

To learn more about tactics and beliefs, here

https://brainly.com/question/30520648

#SPJ1

How did southern leaders react to Rutherford B. Hayes's candidacy in the election of 1876?




A) They opposed him because he was known to be loyal to Great Britain




B)Most opposed him because most of them were Democrats and they were reluctant to vote for a Republican




C) They supported him because he fought for the Confederacy during the Civil War




D) They supported him because they wanted to re-write their own state constitutions

Answers

They supported Rutherford B. Hayes because they wanted to re-write their own state constitutions. Therefore option D is correct

Southern leaders, in particular Democrats, were eager to regain manipulate of their kingdom governments and re-write their constitutions after Reconstruction regulations were implemented inside the wake of the Civil war.

They saw an opportunity to obtain this with the election of Rutherford B. Hayes, a Republican candidate who had pledged to withdraw federal troops from the South if elected.

Southern Democrats believed that Hayes could permit them to regain manage of their nation governments and enforce their very own regulations with out federal interference.

As a end result, a lot of them supported Hayes in the 1876 election, despite the fact that he was a Republican.

Learn more about Rutherford B. Hayes:-

https://brainly.com/question/26061067

#SPJ4

21 Constructed Response
How were women reporters treated during World War II? Write 4 or 5 sentences to
explain. Use details from "Women in the Trenches" to support your response.
Select to begin writing.

Answers

The treatment of women journalists during World War II was varied. They frequently experienced discrimination from male coworkers and were left out of official press conferences.

What difficulties do female journalists face?

Women journalists encounter a number of obstacles at work and on the job, including unequal employment status, gender-based discrimination in duty assignment, poor working conditions, and susceptibility to violence.

What is the media's harmful impact on women?

Girls' self-esteem has been proven to be negatively impacted by the oversexualization of female roles in popular Hollywood movies, which might lead them to wish to change their bodies to resemble the actresses in films and television. In the media, women and girls are prominently featured.

To know more about World War II visit:-

https://brainly.com/question/1449762

#SPJ1

These unsuccessful revolutions contributed to the spread of -



The Revolutions of 1848:



1. Directed against European monarchies



2. Occurred in many countries including France, Germany, Italy, and the Austrian Empire



3. Resulted in military oppression and failure




A. Fascism


B. Industrialism


C. Imperialism


D. Nationalism

Answers

These unsuccessful revolutions contributed to the spread of nationalism.

How did Revolutions of 1848 contributed to nationalism?

The Revolutions series of uprisings against European monarchies which occurred in many countries including France, Germany, Italy and the Austrian Empire. Despite its widespread nature, they ultimately resulted in military oppression and failure.

The uprisings brought attention to the idea of national identity and self-determination because the people from different regions within the empires fought for their own rights and autonomy.

Read more about unsuccessful revolutions

brainly.com/question/29489914

#SPJ1

Create a one pager that thoroughly explains America after the ratification of the new Constitution.

One pager must include information from at least two outside sources (be sure to include citations) and includes the following:

At least 3 important facts about America under Washington and Adams.

Two upper-level questions and answers.

An explanation of how the foreign and domestic challenges faced by Washington and Adams were resolved and how they impacted the role of the Federal Government

Answers

The first federal elections and the effective implementation of the Constitution following its passage were scheduled by Congress.

When the new Constitution was ratified, exactly what took place?

On September 17, 1787, the delegates ultimately approved the United States Constitution. It lacked any sort of Bill of Rights, despite the fact that there had been significant discussion of the subject.

What is the summary of the US Constitution?

The Constitution outlines the three major federal government branches and their respective powers. It also describes the fundamental laws that govern the federal government of the United States. It is the oldest written national constitution that is still in effect and is now regarded as a significant legal text of the Western world.

To know more about Constitution visit:-

https://brainly.com/question/350530

#SPJ1

3. Why was Democrat Woodrow Wilson able to win two presidential elections during an era of Republican Party control?
O Expanded voting rights resulted in more Democratic voters.
O The resignation of a Republican President damaged the party.
O Farmers, laborers, businessmen, and freed slaves supported Wilson.
Republican support was divided between two candidates.

Answers

There were the multiple reasons why Democrat Woodrow Wilson was able to win two presidential elections during an era of Republican Party control. One reason was the expanded voting rights that resulted in more Democratic voters. So the right option is: O Expanded voting rights resulted in more Democratic voters.

Additionally, the resignation of a Republican President, William Howard Taft, damaged the party's reputation. Wilson was also able to garner support from a diverse group of individuals, including the  farmers, laborers, businessmen, and freed slaves.

Lastly, Republican support was divided between the  two candidates, which may have contributed to Wilson's victories.

For more questions on: Woodrow Wilson

https://brainly.com/question/30461705

#SPJ11

what is the relationship between cultural regions and languages in europe

Answers

Europe is a diverse continent with rich cultural heritage and a multitude of languages spoken across its various regions.

What is cultural heritage?

Cultural heritage refers to the tangible and intangible aspects of a society that are passed down from generation to generation. It includes monuments, buildings, artifacts, artworks, customs, traditions, beliefs, and values that have historical, aesthetic, scientific, or spiritual significance. Cultural heritage reflects the identity, diversity, and creativity of a community, and it contributes to the social cohesion, education, and economic development of a country. Preserving and promoting cultural heritage is essential for safeguarding human rights, fostering intercultural dialogue, and enhancing mutual understanding and respect among people. However, cultural heritage is often threatened by natural disasters, climate change, urbanization, conflicts, and globalization, and therefore requires proactive and sustainable strategies for its conservation and management.

To learn more about cultural heritage, visit:

https://brainly.com/question/25203096

#SPJ1

Complete Question:

What is the relationship between cultural regions and languages in Europe?

In the first three chapters, Douglass mentions suffering all of the following struggles EXCEPT:

Answers

Douglass mentions going through all of the following problems, excluding the difficulty of adjusting to life as a free man, in the first three chapters. Here option D is the correct answer.

In the first three chapters of the Narrative of the Life of Frederick Douglass, an American Slave, Douglass mentions suffering from various struggles related to his enslavement. These struggles include lack of access to education, separation from family members, and physical abuse and mistreatment. However, he does not explicitly mention the difficulty of adjusting to life as a free man in these chapters.

Instead, in these chapters, Douglass primarily focuses on his experiences of being born into slavery, his relationship with his mother, and the brutal treatment he witnessed and experienced under various slave owners. He also discusses his early attempts to learn how to read and write, which were met with opposition from his owners.

It is worth noting that while Douglass does not discuss the difficulty of adjusting to life as a free man in these chapters, he does touch on this topic later in the narrative. After he escapes from slavery and becomes a free man, he struggles to adapt to a new way of life, finding it difficult to trust people and navigate society as a black man.

To learn more about Douglass

https://brainly.com/question/9528697

#SPJ4

Complete question:

In the first three chapters, Douglass mentions suffering all of the following struggles EXCEPT:

A) Lack of access to education

B) Separation from family members

C) Physical abuse and mistreatment

D) Difficulty adjusting to life as a free man

What is the relationship between WW2 and the growth of Texas cities

Answers

The relationship between World War II and the growth of Texas cities is complex and multifaceted. The war had a significant impact on Texas, as it did on many other parts of the United States. Here are a few ways in which the war contributed to the growth of Texas cities:

Military Bases: During World War II, Texas became home to several military bases, including Fort Hood, Fort Bliss, and Lackland Air Force Base. These bases brought thousands of soldiers and their families to Texas, which stimulated the growth of nearby cities and towns.

War Industries: Texas also played a crucial role in the war effort by producing war materials, such as oil, gas, and steel. The state's industrial output increased dramatically during the war, which led to the growth of cities like Houston, Corpus Christi, and Beaumont.

Population Growth: Texas experienced a population boom during World War II, with thousands of people moving to the state to work in war-related industries or to serve in the military. This led to an increase in the demand for housing, goods, and services, which helped to fuel the growth of cities throughout the state.

Immigration: The war also had a significant impact on immigration to Texas, with thousands of people coming to the state from Mexico and other Latin American countries to work in agriculture and other industries.

Overall, World War II played a significant role in the growth of Texas cities, as it did in many other parts of the United States. The influx of people, industry, and military bases helped to transform Texas into a major economic and political force in the post-war period.

What economic advantage did the nazis gain from putting jews in ghettos?

the government spent less money on health care...

Answers

The advantage that Nazis gain from putting Jews in ghettos was they used them as cheap labor to create war materials like weapons.

After the Nazis conquered territory in Europe they send Jews people to live in ghettos. Ghettos are some urban areas where minorities live.

During the Holocaust, for the ultimate destruction of European Jews, Nazis forced them to live in ghettos. Not only this they took many advantages of people living in ghettos.

Nazis used them as their workers and use to pay less to them. There was no fixed time of working and brutal behavior was done with them.

Learn more about Jews Ghettos:

https://brainly.com/question/858475

#SPJ4

Complete Question:

What economic advantage did the Nazis gain from putting Jews in ghettos?

The government spent less money on health care for its citizens.

The government used them as cheap labor to create war materials.

The government could train young Jewish men to become soldiers.

The government had less need to deport Jews to other countries.

What is one way specialization allowed the Romans to maintain a diverse empire?



A. Romans conquered other civilizations and made them conform to their ways.


B. Romans learned about new cultures through trading with other civilizations.


C. Rome was the only place where grapes were produced for trade.


D. Rome was the only place where boats were made for trading partners

Answers

Romans learned about new cultures through trading with other civilizations which allowed them to maintain a diverse empire. The correct answer is B.

Specialization allowed the Romans to maintain a diverse empire by facilitating trade and exchange with other civilizations. As the Roman Empire expanded, it encountered a wide range of cultures and peoples with different skills, resources, and technologies.

Rather than trying to conquer or suppress these cultures, the Romans often sought to trade with them and learn from them. This allowed them to incorporate new ideas and technologies into their own society, making it more diverse and adaptable.

For example, the Romans traded extensively with other Mediterranean civilizations, such as the Greeks, Egyptians, and Phoenicians. Through these interactions, they learned about new agricultural techniques, engineering methods, and artistic styles. They also imported goods such as spices, silk, and precious metals, which helped to fuel the Roman economy and create a wealthy merchant class.

Overall, specialization and trade allowed the Romans to create a diverse and interconnected empire that spanned multiple continents and incorporated a wide range of cultures and peoples. This helped to ensure the long-term stability and success of the Roman Empire.

To learn more about Romans refer here:

https://brainly.com/question/23304167

#SPJ11

Choose the answer whose words and symbols best describe the value of each term as a function of its position and also has the value of the sixteenth term in the sequence.


a. add 6; n + 6; 22

b. multiply by 4; 4n; 56

c. multiply by 4; 4n; 64

d. divide by 4; n 4; 4

Answers

To choose the correct answer that describes the value of each term as a function of its position, we need to look at the given sequence and determine the pattern that relates each term to its position. And the correct answer is possibly option C which is multiply by 4; 4n; 64.

The given options represent different functions that can be applied to the position of a term in a sequence to determine its value.Unfortunately, the sequence itself is not provided, and so we cannot determine the correct answer based on its pattern. However, we are given the value of the sixteenth term in the sequence, which can help us eliminate some of the options.Option a suggests adding 6 to the position of each term, which is unlikely to result in a sequence where the sixteenth term is 22. Option b suggests multiplying the position by 4, which would result in a sixteenth term value of 64, not 56. Option d suggests dividing the position by 4, which would result in a sixteenth term value of 4, not 4 times the position.Therefore, the correct answer must be option c, which suggests multiplying the position by 4 to determine the value of each term. If we assume that the first term in the sequence is 1, then the sixteenth term would be 4 times 16, which is 64, consistent with option c.

know more about function here: https://brainly.com/question/11624077

#SPJ11

Which ideas are part of civil law in Louisiana? Check all that apply

Answers

The ideas that are part of civil law in Louisiana include:

primarily protecting the rights of citizensworking to peacefully resolve disputes between citizens.

What ideas are included in civil law in Louisiana?

Louisiana follows a civil law system which is based on Roman law rather than English common law. The state law focus on protecting the rights of citizens and promoting peaceful resolution of disputes between citizens.

This includes areas such as contract law, property law, and family law. Civil law also plays a role in regulating businesses and commercial transactions. Criminal law focuses on punishing people who break the law and commit crimes including both misdemeanors and felonies.

Missing options "A: is broken down into two main categories

B:primarily protects the rights of citizens

C:works to peacefully resolve disputes between citizens

D:punishes people who break the law and commit crimes

E:includes petty theft, possession, and other misdemeanors

F:includes burglary, murder, embezzlement, and other felonies

Read more about Louisiana law

brainly.com/question/30437991

#SPJ1

Which of the following is a reason for the Peloponnesian war breaking out?
A: Sparta and it's allies saw the Athenian empire as a threat
B: The Athenians could no longer defend Greek city-states against the Persians
C: The Spartans saw the Athenians as weak and wanted control of Greece
D: All of the Above

Answers

A: Sparta and its allies saw the Athenian empire as a threat is the reason for the Peloponnesian war breaking out.

during the mod 1800s conflicts between the north and south were centered on which issue. u.s history.​

Answers

Answer:

Slavery

Explanation:

During this time, the Civil War is in midst.  It was the North vs. South, and the topic was over slavery.  There were many acts enacted such as the Missouri Compromise and the Compromise of 1850.

(25 POINTS!!!) A) Choose two examples from the following areas and explain how they are evidence of globalization. Provide an example from each category.



International trade organizations


Immigration


New technologies



B) Explain one major positive effect and one negative effect of globalization on the United States.



pls do both parts! i'd do it on my own but i don't have the book :(

Answers

A) International trade organizations, immigration, and new technologies are evidence of globalization.  B) One major positive effect of globalization on the United States is access to a wider range of goods and services at lower prices, while a major negative effect has been job loss in certain industries due to outsourcing.

A) International trade organizations: One example of an international trade organization as evidence of globalization is the World Trade Organization (WTO). The WTO was established in 1995 and its main objective is to promote and regulate international trade.

Its membership includes over 160 countries, which shows the interconnectedness of economies across the world. The WTO provides a forum for negotiations and dispute resolution on international trade issues, which helps to facilitate and promote globalization.

Immigration: Immigration is another example of evidence of globalization. People are increasingly moving across national borders for work, study, and to be with family. Immigration has increased due to globalization, as transportation and communication have made it easier for people to travel and stay in touch with their home countries.

For example, the United States is a melting pot of different cultures, and the diversity of the population is evidence of globalization.

New technologies: New technologies, such as the internet, smartphones, and social media, have made the world more connected and have facilitated globalization. These technologies have made it easier to communicate and do business across national borders.

For example, online shopping allows consumers to buy products from anywhere in the world, and social media allows people to connect and share information with others from different countries.

B) Positive effect: One major positive effect of globalization on the United States is increased economic growth. Globalization has allowed U.S. companies to expand their markets and sell their products and services to consumers in other countries.

This has led to increased exports and job growth in the U.S. Globalization has also attracted foreign investment to the U.S., which has created jobs and stimulated economic growth.

Negative effect: One major negative effect of globalization on the United States is job loss due to outsourcing. Globalization has made it easier for companies to move jobs to countries where labour is cheaper, which has led to job losses in the U.S.

This has had a negative impact on some communities and has contributed to income inequality. Additionally, globalization has led to the decline of some industries in the U.S., such as manufacturing, as production has shifted to countries with lower labour costs.

To know more about globalization refer here:

https://brainly.com/question/15283031#

#SPJ11

Which texas bill of rights term means that texans are protected from going on trial twice for the same crime? a. due process b. quartering c. double jeopardy d. habeas corpus

Answers

The Texas Bill of Rights term that protects Texans from going on trial twice for the same crime is double jeopardy. The correct answer is c.

This term is a fundamental protection that is enshrined in both the US and Texas constitutions. The principle of double jeopardy means that a person cannot be tried for the same offense twice, once they have been acquitted or convicted of that crime.

This principle ensures that individuals are protected from harassment by the state, as well as from the possibility of being punished twice for the same crime. Overall, the principle of double jeopardy is an essential component of the legal system, as it helps to ensure fairness and protect individual rights.

To know more about double jeopardy, refer to the link:

https://brainly.com/question/26602409#

#SPJ11

Explain the statmemt in hindu raj after british raj would be even wores

Answers

Following the arrival of the British, many changes occurred in Indian society. Though the British and Hindu Raj were adverse, the conditions would also have been poor.

The subcontinent was divided into two separate nation nations in 1947 Hindu-majority India and Muslim-majority Pakistan when the British finally left India after 300 years. Millions of Muslims immediately set out on one of the largest migrations in human history, making their way to West and East Pakistan.

There would still be a climate of distrust among the communities even if there had not been a division. It wouldn't have been a perfect world where everyone gets along. Few Muslims would have attended the assembly if partition had not occurred and India had remained one. Additionally, the Kashmir conflict and the current struggle between India and Pakistan over Kashmir may not have arisen.

Read more about British on:

https://brainly.com/question/28734617

#SPJ4

Complete Question:

explain the statement hindu raj after british raj would be even worse. What could have been the plight of Muslim if lndia had not been divided?

PLEASE HELP QUICKLY 20 points !!!!!!!!!!!!!!!!!!!!!!!!




The Civil War photographs showed the people 'back home' that war was...

(choose all that apply)

Select 3 correct answer(s)
Question 2 options:

magnificent


heroic


noble


tragic


devastating


bloody

Answers

Answer:

heroic and devastating

bcoz either the war is finished by winning or by losing

True or false: the continental divide is a ridge of mountains that causes water to flow either north or south until it reaches an ocean.

Answers

The given statement is True because The Continental Divide is a ridge of mountains that separates the watersheds of the Pacific Ocean from those of the Atlantic Ocean and Arctic Ocean.

It acts as a natural barrier that forces water to flow either north or south until it reaches an ocean. The Continental Divide stretches through much of North America, beginning in the Yukon and Alaska, extending through Canada and the United States, and ending in Mexico.

Along the way, it passes through both the Rocky Mountains and the Sierra Nevada Mountains. The Continental Divide is important because it helps define the borders of Canada, the United States, and Mexico. It also determines which ocean water flows into and its role in the hydrologic cycle.

To know more about Continental Divide, click here:

https://brainly.com/question/31090146

#SPJ4

Other Questions
Los principales componente del sistema linfatico para desarrollar la funcion immunologica son Which psychological disorder is this?Justice talks often about his success in school, athletics, & dating exploits. Justice often expects help from his friends when Justice needs it. However, when Justices friends need help he talks about how unimportant the friend's task is & how important his plans are and how he cant help. Justice is often heard proclaiming to the class how lucky his friends are to have him 16Which graph correctly represents the relationship between arc length and the measure of the corresponding central angle on a circle with radius r? .m. All rights reserved.2 FrArcLengthQ SearchI:3=IA>0 True or False Sociological perspective is basically being able to see the world through another person's eyes. Match each Native American tribe with the language family to which it belongs. Siouan Athabaskan Uto-AztecanTanouanKiowa ApacheOsageComanche KThis passage, Managing Speech Anxiety, is from a communications textbook.Review the passage as needed.wwwA. Although speech anxiety can be cured, most individuals with this condition are not sure where to fincprofessional help and treatment.B.Speech anxiety is a multisystem response; in this state, a combination of biochemical changes arereleased into the body whenever the person is placed in a stressful situation involving communicationOC. Symptoms of speech anxiety include a rapid heartbeat, an increase in blood pressure, and an overflowof adrenaline to other parts of the body.1Next Can someone help me I'm stuck. Alexandria rolled a number cube 60 times and recorded her results in the table. What is the theoretical probability of rolling a one or two? Leave as a fraction in simplest from A spotlight is mounted on the eaves of a house 20 feet above the ground. A flower bed runs between the house and the sidewalk, so the closest the ladder can be placed to the house is 15 feet. How long a ladder is needed so that an electrician can reach the place where the light is mounted If f(x) is defined as follows, find (a) f(-3), (b) f(0), and (c) f(4).xif x < 0if x = 03x + 3 ifx>0f(x) = 0(a) f(-3)= (Simplify your answer.)THE The operating system is not presently configured to run this application. A pressure switch is used in a washing machine to control the flow of water. The water pushes on a flexible container and compresses some trapped air. When the pressure of this trapped air reacher 104 kPa, the pressure switch turns the water off. The pressure of the trapped air is given by this relationship: pressure of the trapped air - atmospheric pressure + pressure difference caused by the water. Calculate the height of water in the machine when the pressurre of the trapped air reaches to 104 kPa and the switch operates. (atmospheric pressure = 100 kPa, density of water = 1000 kg/m^3) How to find out if a solid, more specifically powdered cement, is acid or alkali? Between 1940 and 1955, the average income for a u.s. family tripled. this was likely the result of- reduced unemployment - the expansion of corporations & creation of more white-collar jobs- all of these choices are correct- more women entering the workplace A car repair shop specialises in exhaust pipe replacement. Every year it costs $34,800 to rent the shop and maintain their equipment and $50,000 to pay their employees. For every exhaust pipe replaced the repair shop charges the customer the price of the parts required plus $248 as a service charge. How many exhaust pipe replacements does the repair shop need to complete in order to break even? 4. Calculate and properly express the 2017 accounts receivable turnover ratio for OReilly Auto Parts. ASSUME ALL SALES REPRESENT CREDIT SALES. (6 pts)8,977,726/216,251+197,274/2 = 8,977,726/206762.5 = 43.4 times Answer: 43.4 times5. Calculate and properly express the 2017 (fiscal year ended August 26, 2017) accounts receivable turnover ratio for AutoZone. ASSUME ALL SALES REPRESENT CREDIT SALES. (6 pts)10,888,676/280,733+287,680/2 = 10,888,676/284206.5 = 38.3 timesAnswer: 38.3 times6. Calculate and properly express the average collection period for each company. (6 pts)OReilly Auto Parts: 365/43.4 = 8.4 daysAutoZone: 365/38.3 = 9.5 daysAnswer: OReilly Auto Parts: 8.4 daysAutoZone: 9.5 days7. Which company has a better receivable turnover ratio and why? Explain in three complete sentences. (4 pts)8. Calculate and properly express the 2017 inventory turnover ratio of OReilly Auto Parts. (6 pts)4,257,043/3,009,800+2778,976/2 = 4,257,043/2,894,388 = 1.5 timesAnswer: 1.5 times9. Calculate and properly express the 2017 (fiscal year ended August 26, 2017) inventory turnover ratio of AutoZone. (6 pts)5,149,056/3,882,086+3,631,916/2 = 1.4 timesAnswer: 1.4 times10. Calculate the average days to sell inventory for each company. (6 pts)OReilly Auto Parts: 365/1.5 = 243.3 daysAutoZone: 365/1.4 = 260.7 days Answer: OReilly Auto Parts: 243.3 daysAutoZone: 260.7 days11. Which company has a better inventory turnover ratio? (2 pts) Why, what does this ratio represent? Explain in a short paragraph. (4 pts)I need a answer for n 7 and 11 Which of the following examples of figurative language from the poem best supports the idea that Susan B. Anthony was ahead of her time?A.On ground hard held to the last, gaining her goal for womenB. Her life is a luminous banner bome ever ahead of her eraC. Her spirit like southern starlight at once is afar and around usD. In the mine, the mill and the mart where is bartered the bread of your children At what condition do magnesium chloride and silver nitrate react? this is due now !!!!!!!! 98. How many start codons are there?99. How many stop codons are there?100.101. The process of translation takes place in the102. Replication and Transcription both take place in theSecond baseFirst baseUGUUUUUCUUAUUGCUUCUCCUACUGsignals the end of the process ofGUUGUCGUAGUGlek ne(LewAUUAUCAUAAUG theone (Met)(ke)ne(Val)UCUUCCUCAUCGCCUCCCCCACCGACUACC theACA(MhviACGGCUGCCGCAGCGAlaUAUUACUAAUAGAAUAACCAU histidineCACCAACAG6AAAAAGGAUGACtyfouneGAAGAGSTOPgutamineof the cell.(Avilboneof the cell.UGUUGCUGAUGG tryptophan (1)CGUCGCCGACGGAGUAGCAGAAGGpart and GGUGGOGGAGGGKVMargune(Arg)(Gly)DYSCU3Third baseGC A museum sells stone souvenirs shaped like a cone with a diameter of 4.2 centimeters and a height of 9.5 centimeters. What is the volume of each souvenir? Round to the nearest tenthPLEASE HURRY