Which is the closest to 6.5x10-47
A. 0.065
B. 0.0065
C. 0.00065
D. 0.000065
E. 0.0000065

Answers

Answer 1

Answer:

Step-by-step explanation:

B


Related Questions

Need help with 11. . . .

Answers

Answer:  C) 46

===========================================

Explanation:

You have the right idea, but keep in mind that it says consecutive even integers. So we're only looking at numbers like 2,4,6,8,... and these numbers must follow one right after another. If that "even" wasn't there, then your answer and steps would be 100% correct.

If x is an even number, then x+2 is the next even number, and x+4 is the one after that.

Add them up to get

(x)+(x+2)+(x+4)

x+x+2+x+4

(x+x+x)+(2+4)

3x+6

Then divide by 3 to compute the average

(3x+6)/3

3x/3 + 6/3

x+2

Set this average equal to 48 and solve for x

x+2 = 48

x = 48-2

x = 46 is the smallest number

x+2 = 46+2 = 48 is the middle value

x+4 = 46+4 = 50 is the largest

Note how the middle value is exactly the average. This is because we have symmetry going on here.

It's similar to how the average of the set {1,2,3} is 2 since 2 is in the middle.

-------------------

Check:

add the values: 46+48+50 = 144

divide by three: 144/3 = 48

The average of the set {46,48,50} is 48

This confirms the answer

The sun produces 3.9 ⋅ 1033 ergs of radiant energy per second. How many ergs of radiant energy does the sun produce in 1.55 ⋅ 107 seconds?

Answers

Answer:

[tex]E=3.97\times 10^{-27}\ \text{ergs}[/tex]

Step-by-step explanation:

It is given that,

The sun produces [tex]3.9\times 10^{33}\ \text{ergs}[/tex] of radiant energy per second.

We need to find how many ergs of radiant energy does the sun produce in [tex]1.55\times 10^7\ s[/tex].

Energy produced in 1 seconds = [tex]\dfrac{1}{3.9\times 10^{33}}\ \text{ergs}[/tex]

In [tex]1.55\times 10^7\ s[/tex], energy produced is :

[tex]E=\dfrac{1}{3.9\times 10^{33}}\times 1.55\times 10^7\ \text{ergs}\\\\=3.97\times 10^{-27}\ \text{ergs}[/tex]

Hence, the radiant energy produced in 1 second is [tex]3.97\times 10^{-27}\ \text{ergs}[/tex].

Answer:

Part A: It is given that,

The sun produces 3.9x10^33 ergs of radiant energy per second.

We need to find how many ergs of radiant energy does the sun produce in 1.55 x 10^7 s

Energy produced in 1 seconds =  1/3.9 x 10^33 ergs

In 1.55 x 10^7 s energy produced is : E=3.9/10^33 x 1.55 x 10^7 ergs

= 3.97 x 10^-27 ergs  

In conclusion the radiant energy radiated per second 3.97 x 10^27 ergs

Step-by-step explanation:

Suppose y varies directly as x, and y = 21 when x = 3. Find x when y = 42.

Answers

Answer:

x = 24

Step-by-step explanation:

y₂ - y₁

42 - 21 = 21

x + 21

3 + 21 = 24

So when y increases by 21, so does x.

x = 24

2. 1. POINT A HAS COORDINATES (4,6) AND POINT O IS AT THE ORIGIN. FIND THE DISTANCE FROM O TO A. A 6​

Answers

Answer:

√52 units

Step-by-step explanation:

Here we want to find the distance between two points;

O(0,0) and A (4,6)

We can use the distance formula to find this;

D = √(x2-x1)^2 + (y2-y1)^2

D = √(4-0)^2 + (6-0)^2

D = √(16 + 36)

D = √52

So the distance between the two points is √52 units

a coach bought three soccer balls on sale. they normally sell for $26 each. they were on sale for $7 off the original price. the total tax on the ball was $4 . the expression represents the total amount paid. Then explain how to use the order of operations to find the total amount the coach paid for the soccer balls.

Answers

Answer:

The coach paid $69 on the three soccer balls

Step-by-step explanation:

If the coach bought 3 soccer balls for 26$, minus the $7 on each, plus the $4 tax on each, the expression would be:

3 × (26 - 7 + 4)

We put the addition and subtraction in parentheses because of PEMDAS. PEMDAS say we must solve for whatever is in the parentheses first, then exponents (there are none in the expression), ans then multiplication. If those numbers were not in parentheses, the answer would look completely different as we would multiply before subtracting and adding. We must find the total amount each ball cost first:

26 - 7 + 4 = 23

Each ball cost $23

If the coach bought 3 balls for $23 each, we have to multiply the two numbers:

3 × $23

$69

Enter the correct answer in the box. What is the standard form polynomial that represents this product?
(-2m3 + 3m2 - m)(4m2 + m - 5)​

Answers

Answer: -8m^5+10m^4+9m^3-16m^2+5m

Step-by-step explanation:

I had this question on a recent test and got it right

Hope this helps! :)

Answer:

The correct answer is:

-8m^5+10m^4+9m^3-16m^2+5m

Step-by-step explanation:

I got it right on the Edmentum test.

find the measure of each angle.


m m

Answers

Answer:

BAC = 58, CAD = 32

Step-by-step explanation:

The angle of BAD is 90 degrees, this is represented by the red outline of a square. This means that adding angles BAC and CAD will equal 90.

15x - 2 + 7x + 4 = 90

Combine common terms

22x + 2 = 90

Solve for x

22x = 88

x = 4

Now you can plug x into the equation for each angle to find its value.

Angle BAC

15x - 2 = 15(4) - 2 = 60 - 2 = 58 degrees

Angle CAD

7x + 4 = 7(4) + 4 = 28 + 4 = 32 degrees

Translate the statement into an algebraic inequality. The quotient of a number and five is no greater than negative nine.

Answers

Answer:

[tex]\frac{x}{5} < -9[/tex]

Step-by-step explanation:

Let x be the number

"The quotient of a number and five" means the answer of x divided by five"Is no greater than negative nine" means is less than -9Put them together: [tex]\frac{x}{5} < -9[/tex]  

I hope this helps!

M a right angle. 2 lines form a right angle. Another line extends between the 2 lines to form 2 angles. The top angle is labeled 1, and the bottom angle is labeled 2. Which word describes their measures? linear congruent complementary supplementary

Answers

Answer:

i think it's congruent .

Step-by-step explanation:

Answer:

complementary i believe

Step-by-step explanation:

smoovin

Find the mean absolute deviation for the set {-32,9,11,12}


A)0

B)8

C)16

D)32

Plssss help

Answers

Answer:

The answer is A i think.

Step-by-step explanation:

Im taking the test lol.

Answer:

The answer is 16

Step-by-step explanation:

Find the slope. ( include whether positive or negative.)​

Answers

Answer:

that is a negative slope

but dont know how to find the slope sorry

Step-by-step explanation:

[tex]\tt Step-by-step~explanation:[/tex]

Remember: To find the slope, we use the equation Rise/Run.

[tex]\tt Step~1:[/tex]

Let's find the rise first. Rise = How many units it goes up/down We can count down 6 units from the origin. Our rise is - 6.

[tex]\tt Step~2:[/tex]

To find the run. we count left/right. We could count 8 units. Our run is 8.

The slope is negative because it slopes downwards. If the slope is positive, then the line would be rising up.

[tex]\tt Step~3:[/tex]

To find the slope, we use the formula rise/run.

[tex]\tt \frac{-6}{8}=-\frac{3}{4}~or~ -0.75[/tex]

[tex]\large\boxed{\tt Our~final~answer:~m=-\frac{3}{4}~or~-0.75;~Negative~slope}[/tex]

3(a+3)+6=30 Solve for a.

Answers

Answer:

a = 5

Step-by-step explanation:

3 (a + 3) + 6 = 30

Use the distibutive property to multiply 3 by a + 3

3a + 9 + 6 = 30

Add 9 and 6 to get 15

3a + 15 = 30

Subtract 15 from both sides

3a = 30 - 15

Subtract 15 from 30 to get 15.

3a = 15

Divide both sides by 3.

a = 15/3

Divide 15 by 3 to get 5

a = 5

Answer this question... ( ^__^ )

Answers

Answer:

The answer is C

Step-by-step explanation:

The lowest point on the graph of a parabola that opens up is the what of the parabola?
a. range
b. axis of symmetry
c. vertex
d. domain​

Answers

Answer:

c the vertex

Step-by-step explanation:

hope this helps!

C. Vertex



Explanation:

If the parabola opens up, the vertex represents the lowest point on the graph, or the minimum value of the quadratic function.

The sun of D and 5 is greater than or equal to -1 and the sun of D and 5 is less than or equal to 4. List 3 integers that satisfy the inequality

Answers

Answer:

-5, -2, -1

Step-by-step explanation:

Inequalities

The question provides us with two conditions:

D+5≥-1

D+5≤4

Solve the first inequality. Subtract 5 to both terms:

D≥-1-5

D≥-6

Solve the second inequality. Subtract 5 to both terms:

D≤4-5

D≤-1

We must find three numbers that comply with both conditions, i.e. it must be greater or equal -6 and less or equal than -1. Any integer number in the interval [-6,-1] solves the problem. We select the following list:

-5, -2, -1

3x+8=13x-8x. Also it’s asking me to check can you send a check too thanks

Answers

Answer:

x = 4 CAN I HAVE BRAINEST PLZ

Step-by-step explanation:

3x + 8 = 13x - 8x (collect like terms)

3x + 8 = 5x (subtract 3x on both sides)

8 = 2x (divide by 2 on both sides)

4 = x

CHECK

3(4) + 8 = 13(4) - 8(4)

12 + 8 = 52 - 32

20 = 20

Calculate the mean ,median, or mode of a distribution. There are 10 bags containing tickets numbered 1 to 20. Ten students draw a ticket from each bag. One student drew tickets with the numbers. 5,8,18,1,14,6,8,13,8,19 what would be the correct mean, median, and mode

Answers

Answer:

Step-by-step explanation:

Mean = sum of variables/sample size

Sum of variables = 5+8+18+1+14+6+8+13+8+19

Sum of variables = 100

Sample size = 10

Mean = 100/10

Mean = 10

Median is the value at the centre after rearrangement.

On rearrangement

1,5,6,8),8,8,(13,14,18,19

Median = 8+8/2

Median = 16/2

Median = 8

Mode is the value with the highest frequency. The value that occur the most. From the datas, the mode is 8 since it occurred 3 times.


Identify the odd function.
A) f(x) = 5
B) f(x) = 8x
C) f(x) = |x3|
D) f(x) = x2 + 7

Answers

Answer:

Step-by-step explanation:

odd functions are those function in which  

-f(x) = f(−x)  

if the function is odd , the graph of function is symmetrical about origin.

_________________________________________________

In the given problem

option B is correct answer

B) f(x) = 8x

replacing x with -x to satisfy the above described condition

f(-x) = 8(-x) = -8x

as we know 8x is equal to f(x)

f(-x) = -8x = -f(x)

hence,

f(-x) = -f(x)

hence, option B is correct answer.

What is division problem has the same quotient as -27 Divided by9

Answers

Answer:

-9/3

Step-by-step explanation:

A multiple-choice test with 50 questions has five possible choices for each question. There are 4 points for each correct answer, -1 point for each incorrect answer, and 0 points for each unanswered question. What is the total score of a student with 35 correct answers, 10 incorrect answers and 5 unanswered questions?

Answers

Answer:

130 points

Step-by-step explanation:

Answer:

130 points

Step-by-step explanation:

PLEASE HELP!!! ILL GIVE BRAINLIEST

Answers

Answer:

*gives help*

:)

Step-by-step explanation:

help on math angle question. ik its easy but I have no idea how math works :D

Answers

Answer:

71º is measure of angle A

19º is measure of angle B

Step-by-step explanation:

complementary angles are angles that equal to 90º 

so let's add the terms (from angles A & B) and set them equal to 90º

3x+2 + x-4 = 90

4x -2 = 90

add 2 to both sides to get rid of the 2 on the left side and isolate our similar terms

4x = 92

divide both sides by 4

x=23

We're not done though, we must plug in our x value to Angle A terms and Angle B terms.

(3(23) + 2)º = measure of Angle A            (solve for both of them)

(23-4)º =  = measure of Angle B

3(23) + 2 =

3(23) = 69 (add the 2)

71º is measure of angle A

23-4 = 19º

19º is measure of angle B

double-check

71+19 = 90º

It works

Answer:

71º is measure of angle A

19º is measure of angle B

Step-by-step explanation:

Find the equation of the line in slope-intercept form. c Slope is 3/5 and (0, −2)

Answers

Answer:

y=3/5x-2

Step-by-step explanation:

The slope is already given, 3/5 so just plug it in to the base formula y=mx+b

And the coordinate (0,-2) is your y-intercept. So plug in -2 to b

Therefore y=3/5x-2

If x+ 9 = 11, then x = 2.

Answers

x would equal 2...

Step-by-step explanation:

true.

Answer:

Yes, you are correct.

Step-by-step explanation.

We will flip the question.

11 - 9 = x

is the same as.

11 - 9 = 2...

________________________________________________________

So... x = 2.

Evaluate the expression below using the properties of operations. Show your steps to receive full credit. −36 ÷ 14 ⋅ (−18) ⋅ (−3) ÷ 6

Answers

Answer:

(-162)/7 or -23 1/7 as a mixed fraction

Step-by-step explanation:

Simplify the following:

(-36)/14 (-18) (-3)/6

Hint: | Express (-36)/14 (-18) (-3)/6 as a single fraction.

(-36)/14 (-18) (-3)/6 = (-36 (-18) (-3))/(14×6):

(-36 (-18) (-3))/(14×6)

Hint: | In (-36 (-18) (-3))/(14×6), divide -18 in the numerator by 6 in the denominator.

(-18)/6 = (6 (-3))/6 = -3:

(-36-3 (-3))/14

Hint: | In (-36 (-3) (-3))/14, the numbers -36 in the numerator and 14 in the denominator have gcd greater than one.

The gcd of -36 and 14 is 2, so (-36 (-3) (-3))/14 = ((2 (-18)) (-3) (-3))/(2×7) = 2/2×(-18 (-3) (-3))/7 = (-18 (-3) (-3))/7:

(-18 (-3) (-3))/7

Hint: | Multiply -18 and -3 together.

-18 (-3) = 54:

(54 (-3))/7

Hint: | Multiply 54 and -3 together.

54 (-3) = -162:

Answer: (-162)/7

3to the 4 power times 2to the Third power

Answers

Answer:

648

Step-by-step explanation:

[tex]3^4 \cdot 2^3 = 3 \cdot 3 \cdot 3 \cdot 3 \cdot 2 \cdot 2 \cdot 2 = 81 \cdot 8 = 648[/tex]

Answer:

648

Step-by-step explanation:

Step 1:

First, make an equation:

3⁴ · 2³

Step 2:

Then, simplify both factors:

3⁴ = 81

2³ = 8

Step 3:

Finally, multiply the numbers together:

81 · 8

And you will get 648.

A cat can run 30 mph at this rate how many minutes would it take a cat to run 1.5 miles

Answers

The cat runs 30 miles in one hour so:

(1.5 / 30) = 0.05 hours or 3 minutes

Answer:

Use a proportion::

time/dist = time/distance

t/1.5 = 1/30

t = 1.5/30

t = 15/300

t = 1/20 = 5/100 = 0.05

So A-0.05 is the final answer

Step-by-step explanation:

ik this was 3 yrs ago

hayden places these four blocks into bag
he pick one block wihtout looking
what is the probability that the block hayden picks has a letter on it

Answers

Answer:

1/4

Step-by-step explanation:

4 blocks have been picked, but just one wasn't looked at, therefore only that one has the letter.

Triangles J K L and P Q R are connected at points K and Q. The lengths of sides J K and Q P are congruent and the lengths of sides K L and K R are congruent. Angles L K J and R Q P are congruent.
Which rigid transformations would map ΔJKL onto ΔPQR? Select the three correct answers.

a reflection only
a rotation only
a rotation and a reflection
a translation and a reflection
a translation only

Answers

Answer:

acd

Step-by-step explanation:

edg 2021

A reflection only, a rotation and a reflection and a translation and a reflection are the transformations that would map ΔJKL onto Δ QPR.

What is Congruency

Triangles that are identical in size and shape are said to be congruent triangles. Inferred from this is that the matching sides and angles are equal. Without checking each of the triangles' sides and angles, we can determine whether the two triangles are congruent.

Rule of Congruency:

1- SAS (Side-Angle-Side): Two triangles are congruent if two sides and the included angle of one triangle are equal to the two sides and the included angle of the other triangle.

2- ASA (Angle-Side-Angle): Two triangles are congruent if two triangles and the included side of one triangle are equal to two angles and the included side of the other triangle.

3- AAS (Angle-Angle-Side): Two triangles are congruent if any two pairs of angles and one pair of corresponding sides are equal.

4- SSS (Side-Side-Side): If three sides of one triangle are equal to the three sides of another triangle, then the two triangles are congruent.

5- RHS (Right angle- Hypotenuse-Side): If in two right triangles the hypotenuse and one side of one triangle are equal to the hypotenuse and one side of the other triangle, then the two triangles are congruent.

Since JK= QP
KL= KR
Angle LKJ= Angle QRP

So Δ LKJ ≅ Δ QRP.

Learn more about Congruency here
https://brainly.com/question/2102943

#SPJ10

Help this is due today!

Answers

Answer:

that looks hard! gl :)

Step-by-step explanation:

EF and AB are the same distance apart and AC BD are the same distance apart
Other Questions
In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services. 275,000 plus 5.4 times 10 to the 5th power Whats a religion ??? Javier has a basket of oranges and apples. The number of oranges is 2 more than twice the number of apples in the basket. The difference of half the number of oranges and half the number of apples is 4.An equation created to find the number of apples Javier has in the basket will have What are all the correct equations factorizar por el motodo de aspas [tex]12x^2 = 3x + 2[/tex] Consider this expression. -3x2- 24x - 36 What expression is equivalent to the given expression? Read the poem. Then, select the correct answerexcerpt adapted fromI Wandered Lonely as a Cloudby William WordsworthI wandered lonely as a cloudThat floats on high o'er vales and hills,When all at once I saw a crowd,A host, of golden daffodils;Beside the lake, beneath the trees,Fluttering and dancing in the breeze,Continuous as the stars that shineAnd twinkle on the milky way.They stretched in never-ending lineAlong the margin of a bayTen thousand sawl at a glance,Tossing their heads in sprightly dance.For oft, when on my couch I lieIn vacant or in pensive moodThey upon that inward eyeWhich is the bliss of solitude:And then my heart with pleasure fills,And dances with the daffodils.Which word best describes the author's tone?Aadmiring.desperateOC somberOD playful \How does the allusion to Ham affect the meaning of the text?It emphasizes Douglass's desire to be free.It allows Douglass to discredit using the Bible to justify slavery.It highlights the similarities between enslaved people and those who enslave them.It compares slavery in the modern world to slavery in Biblical times. Write the definition of a function named count that reads all the strings remaining to be read in standard input and returns their count (that is, how many there are) So if the input was: hooligan sausage economy ruin palatialthe function would return 5 because there are 5 strings there. PLSS HELPP What is the value of x in this equation?4x 2(2x 2) = 2(2x 4) The company's profit will be exactly $0 if it makes and sells jackets. The company will make a profit if it makes and sells jackets, but will not make a profit if it makes and sells jackets why are Hispanics not a race in the u.s but only defined as ethnicity? Leann is learning about chemical reactions. She wants to create a model of a chemical reaction, so she is examining the information that she should include. What are the different components that she should include in her model? Choose the three that apply.A.the kinds of atoms that form during a reactionB.the kinds of molecules involved in the reactionC.the kinds of elements that make up a moleculeD.whether the molecules are products or reactantsE.whether the products have more mass than the reactants which part of the government according to the constitution, should be made up to two representatives per state? (Apex) A. the senate B. congress C. the Articles of confederation D. the House of representatives (4x5)+6x4+(9-3) (5+6) show your work Help people. Im so tired and I cant even guess what it can be !