Which of the following college courses would be necessary when obtaining a degree in risk management?
Advanced Decision analysis
Pharmacology
Microbiology
Basic anatomy

Answers

Answer 1

Answer:

A. Advanced Decision analysis

Explanation:

Risk management can be defined as the process of identifying, evaluating, analyzing and controlling potential threats or risks present in a business as an obstacle to its capital, revenues and profits. This ultimately implies that, risk management involves prioritizing course of action or potential threats in order to mitigate the risk that are likely to arise from such business decisions.

Hence, the college course which would be necessary when obtaining a degree in risk management is Advanced Decision analysis because it will help you to measure, analyze and build decisions such as cluster analysis towards risk management and analysis.

Answer 2

Answer:

Advanced decision analysis

Explanation:

I took the quiz on edge


Related Questions

which I true of the rock layers shown below​

Answers

Answer:

C

Explanation:

The fossil can get lifted due to water and other components

Joe Mama!!! Jk it’s C

Would the construction of this master-planned community impact the carrying capacity of the state’s ecosystem?

Answers

Answer:

Are you against or with?

Explanation:

,.;1q23wt4y5eu6ri7ertyur

What properties of carbon explain carbon’s ability to form different large and complex structures?

Answers

Carbon is four valence electrons they bond to the other carbon atoms

Which organelle houses the genetic material DNA?

Answers

Answer:

Image result for Which organelle houses the genetic material DNA?

nucleus

The nucleus is a membrane-enclosed organelle, found in most eukaryotic cells, which stores the genetic material (DNA).

Explanation:

Nucleus is the organelle that houses the genetic material DNA.

What do you mean by organelle?

"An organelle is a subcellular structure that has one or more specific jobs to perform in the cell, much like an organ does in the body."

What do you mean by genetic material?

"Any material of plant, animal, microbial or other origin that carries genetic information and that passes it from one generation to the next is called genetic material."

What do you mean by DNA?

"DNA or deoxyribonucleic acid is a long molecule that contains our unique genetic code."

What is called a nucleus?

"A nucleus, as related to genomics, is the membrane-enclosed organelle within a cell that contains the chromosomes. An array of holes, or pores, in the nuclear membrane allows for the selective passage of certain molecules (such as proteins and nucleic acids) into and out of the nucleus."

To know more about organelle, genetic material and DNA here https://brainly.com/question/16653190

#SPJ2

Why is using the presence of chromosomes inside of a cell NOT a reliable method to
determine if the cell is a prokaryote or a eukaryote?

Answers

Because both prokaryotic and eukaryotic cells have chromosomes (prokaryotes, and more specifically, bacteria, generally have just one chromosome, but there are some bacteria as well as archaea—which are also prokaryotes—that have multiple chromosomes).

Since the chromosomes are DNA molecules present in both the prokaryotic and eukaryotic cells, it is not a reliable method to determine if a cell is prokaryotic or eukaryotic

The nucleus of a eukaryotic cell is bounded by internal membrane, therefore, it is distinctive.

In contrast, the nucleus of a prokaryotic cell lacks internal membrane, hence its nucleus is not distinctive.

Chromosomes are Deoxyribonucleic (DNA) molecules that carry genetic information of a cell or organism.

The chromosomes are present in both the eukaryotic and prokaryotic cells. Chromosomes present in the eukaryotic cells are called eukaryotic chromosomes while chromosomes present in the prokaryotic cells are called prokaryotic chromosomes.

Since the chromosomes are DNA molecules present in both the prokaryotic and eukaryotic cells, it is not a reliable method to determine if a cell is prokaryotic or eukaryotic

Learn more here: https://brainly.com/question/2088739

plz help I will mark you brainlist plz ​

Answers

Answer:

1. Acid

2.  Acid

3. Acid

4. Base

5. Acid

6. Bases

7. acid

8. base

9. acid ( could be both)  

10. acid

*Anybody correct me if I'm wrong*

Explanation:

I need help for this one

Answers

Answer:

Cl2

Explanation:

Answer: Cl2           Hope this helps!

Explanation:

does fab laundry detergent contain enzymes

Answers

Answer:

yes

Explanation:

almost all detergent has enzymes to help clean

describes natural selection?

Answers

Simply, natural selection is that the genetically strongest organisms will be the ones that are able to survive and reproduce, which eliminates weak characteristics, and keeps the strong ones. Survival of the fittest.

(01.05 LC)
Which of the following is the process used by producers that allows energy to be stored in glucose?
A) Cellular respiration
B) Consumption
C) Decomposition
D) Photosynthesis

Answers

The correct answer is D.

29. If lens A is labeled with 10x and the lens in use on B is labeled with 4x, What would
the total magnification be for the fruit fly you are looking at under the microscope?
a. 4000x
C. 400x
b. 40x
d. 4x

Answers

Answer:

B is the correct answer

Explanation:

4x10=40

4a. Describe two examples of non-living things that have one or more of these characteristics of
life.

Answers

Answer:

Water and Air

Explanation:

Water and air both are missing cells that living things have.

You're enjoying playing with your neighbor's new kittens. You notice than some of them look identical to the mama cat, while others looks different from the mom and from each other. You remember from your science class that traits are inherited from parents. All BUT ONE of these traits is inherited.

Answers

Answer:

The answer is WEIGHT

Explanation:

why are index fossils useful to geologist

a.they tell the relative age of the rock in which they occur

b. they tell the ages of many different rock layers

c.they tell the age of the rock at one location only

d. they tell the absolute age of the rock in which they occur

Answers

Answer:

Explanation:

Index fossils (also known as guide fossils or indicator fossils) are fossils used to define and identify geologic periods (or faunal stages). Index fossils must have a short vertical range, wide geographic distribution and rapid evolutionary trends.

Index fossil, any animal or plant preserved in the rock record of the Earth that is characteristic of a particular span of geologic time or environment. A useful index fossil must be distinctive or easily recognizable, abundant, and have a wide geographic distribution and a short range through time. Index fossils are the basis for defining boundaries in the geologic time scale and for the correlation of strata. In marine strata, index fossils that are commonly used include the single-celled Protista with hard body parts and larger forms such as ammonoids. In terrestrial sediments of the Cenozoic Era, which began about 65.5 million years ago, mammals are widely used to date deposits. All of these animal forms have hard body parts, such as shells, bones, and teeth, and evolved rapidly.

i need help asap please
15 points

Answers

Answer:yes that is right you got it

Explanation:

Answer:

its D

Explanation:

photosynthesis happens with thy sun

why producing 1 kg of beef requires much more water than growing 1 kg of potatoes?​

Answers

Answer:

Meat production requires a much higher amount of water than vegetables. IME state that to produce 1kg of meat requires between 5,000 and 20,000 litres of water whereas to produce 1kg of wheat ...

Explanation:

Answer:

compared to beef vegetables require less water like potatoes it takes 287 litres of water


Observing Footprints from the Past
detective"O" (observation) or I (inference)

Answers

Answer:

dfvas

Explanation:

sadvadsssssss

are lipids that serve as chemical messengers.
a
RNAs
b
Enzymes
C Steroids
d Proteins
Check it

Answers

Answer:

C. Steroids

Explanation:

Some lipids such as steroid hormones serve as chemical messengers between cells, tissues, and organs, and others communicate signals between biochemical systems within a single cell.

Answer:

steroids

Explanation:

so c

HELP PLEASE

Each myofibril is made up of arrays of parallel filaments. The thickbands are called _____ and the thin bands are called _____.

Answers

Answer:

A band , I band

Explanation:

YOURE WELCOMEEE

Help !!!!!!!!!!!!!!!!!!!!!

Answers

Answer: I would say D or the last answer

Explanation:

Which has been observed in the study of embryology?

A.Species whose embryos have similar traits rarely have a common ancestor.
B.Species whose embryos have similar traits always have similar body forms as adults.
C.All traits present in early embryos remain throughout development.
D.Some traits in certain embryos disappear as the embryo develops.

Answers

Answer:

D. Some traits in certain embryos disappear as the embryo develops

Explanation:

I don't know how I would explain it, but I can list some of the things that disappear such as...  Gill slits, and tails. Hope this helped :D

Answer:

D. Some traits in certain embryos disappear as the embryo develops.

Explanation:

Embryology is the study of embryos. Embryos of different animals such as mammals, birds, fish, reptiles etc. look alike that is they are very similar. Many traits of one type of animal appear in the embryo of another type of animal.

When and how were the first trans fats made with vegetable oil?

Answers

Answer:

Artificial trans fat dates back to the early 1900s when German chemist Wilhelm Normann found that liquid vegetable or fish oils could be treated with hydrogen gas to make them solid or semi-solid.

According to cell theory, which of the following are made of cells? Check all that apply.

- flowers
- rocks
- blood
- water
- bacteria
- sugar
- skin

Answers

Answer:

flowers

blood

bacteria

skin

According to cell theory flowers, blood, bacteria and skin all are made up of cells.

What is cell theory?

The cell theory is a scientific theory that was initially developed in the middle of the nineteenth century, which states that all living organisms are composed of cells, that cells are the fundamental structural/organizational unit of all organisms, and that all cells originate from pre-existing cells.

Knowing that all living things are cells helps us comprehend how they are born, grow, and die. That information helps us understand how new life is produced, why creatures take their forms, how cancer spreads, how diseases can be handled, and more. Cells help us grasp life and death: a living creature is alive, while a dead one is dead.

Therefore, flowers, blood, bacteria and skin all are living things made up of cells.

Learn more about cell theory, here:

https://brainly.com/question/1468725

#SPJ2

When an organism consumes other organisms for food they are?

Answers

Answer:

Consumer

Explanation:

Producer An organism that can make its own food

Consumer An organism that obtains energy by feeding on other organisms

herbivores consumers that eat only plants

carnivores consumers that eat only animals

A consumer because they eat other animals

*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC

Answers

Answer:

which are the letters with hightlight yellow?

Some one please help me!!!

Answers

Answer:

time

Explanation:

Answer:

revolution

Explanation:

What is the primary source of energy in a food change

Answers

Answer:

It is the sun in most ecosystems as the light energy is fixed during photosynthesis and then transferred to other organisms via the food chain.

Explanation:

Why do you think the size of a white dwarft affects its visual luminosity?

Answers

The bigger the size the more easier to see from a distance and the smaller the harder to see from a distance

Answer:

White Dwarfs are extremely difficult to detect as they are quite small compared to a Star. If the area is small the Luminosity is low, which would make it harder to see the white dwarfs due to the low amount of its luminosity.

Explanation:

Search the NIH gene database for the term colorblindness. Use the results of the database search to explain how a father and mother who are not colorblind could have a son who is colorblind. Your model can be a pedigree chart, a Punnett square, or a diagram of chromosomes.

Answers

Answer/Explanation:

Red/green colorblindness is a recessive, X-linked condition. That means that the affected gene is on the X chromosome, and that the phenotype will only be present if there is no "healthy" gene, which is dominant to the mutated gene.

For two unaffected people to have an affected son, the mother must be a carrier. Remember, females have two X chromosomes and males have one. So if a female is a carrier of the colorblindness mutation, she will have one copy of the mutation and one normal copy of the gene, and will therefore be unaffected.

The punnet square (attached) shows that all their female children would be unaffected (have the B gene), but 1:2 male children would be colorblind, as their only copy of the gene is mutated (b).

Answer:

The person on top is awesome appreciate!!

Explanation:

got it right on edmmentum

Viral DNA that is integrated into a bacterial chromosome is a

Answers

Answer:

Hidden virus.

Explanation:

It will sit in the cell's DNA for a while and then attack.

Other Questions
Tien Chou's tax return for last year shows a total tax of $8,278. Tien's employer withheld $8,450 from her wages during the year. What refund should Tien receive both the kush and the maurya experienced a decline in their empires caused by Given m||n, find the value of x.t>m(6x-9)(5x+10) Select the correct order of the human body's hierarchical system that builds from SMALLEST to LARGEST units. * Tissue - Cellular - Chemical - Organism - Organ - Organ System Chemical - Cellular - Tissue - Organ - Organ System - Organism Cellular - Tissue - Chemical - Organ - Organ System - Organism Organism - Organ System - Organ - Tissue - Cellular - Chemical 6Directions - Determine the correlation for the situation. Choose Positive/ Negative/ or No correlation for each.The outside temperature in the summer and the cost of the electric bill (for air conditioning).A) Positive correlationB Negative correlationNo Correlation hey guys I am new!!!!!!!! WIIL GIVE BRAINLIST, ANSWER ALL , FOR THE GIRLS!!!!!!!!!!!!!!!!What Is The Most Important Thing That Guys Should Understand About The Girl, And It Seems To You That They Do Not Understand?What Is The Most Useless Thing Youve Ever Bought?Which Decade Do You Think Had The Best Sense Of Style? _____ is a movement in which people believe in strictly following certain established principles and teachings. A Monotheism B Culture C Fundamentalism D Globalization Sarah is y years old now. How could you represent her age 5 years ago?y + 55yy - 5y 5 Can someone help me please Many African Americans elected to office during Reconstruction felt a specialpressure to:A. Work independently from peers.B. Prove they could succeed in politics. C. Convince citizens to pledge loyalty.D. Bring federal money to their states. I don't even know what this means I need help What distribution of clothing should Nancy have for German males and females? Should she produce more small or large sizes, or should she have an even distribution of all sizes? Have you ever wondered how a vending machine "knows" that you have put in the correct amount of change to purchase a snack or a drink? These machines use coin detectors that determine the mass and the size of the coins deposited. In other words, they analyze the density of the coins. United States coinage is minted within very narrow specifications, so the density of each type of coin is always the same. The coin detectors compare the coins inserted to the preset standards to determine if the correct combination of coins has been deposited. In this lesson, you too will determine the density of various coins. OBJECTIVES Recognize the characteristics of density. Design and carry out a scientific investigation. Present your findings in a scientific report. Online Lab This animation will allow you to find the density of a penny, a nickel, and a quarter. Make a hypothesis in which you suggest which coin will have the highest density and which will have the lowest density. A model hypothesis might be: "If the (fill in the name of a coin) has a greater density than the _____ and _____, then it will have a greater mass to volume ratio. If the (fill in the name of a coin) has a lower density than the _____ and _____, then it will have a lower mass to volume ratio. Remember to record your data and observations in the data sheet so that you can use them to present your findings. SHOW TRANSCRIPT Present Your Findings Write a one or two summary paragraph discussing this experiment and the results. Use the following questions and topics to help guide the content of your paragraph. According to your data, was your hypothesis correct? (Be sure to refer to your data when answering this question.) Summarize any difficulties or problems you had in performing the experiment that might have affected the results. Describe how you might change the procedure to avoid these problems. List at least two real world examples that apply the findings of this experiment. (Hint: An example of this type was given in the introduction to this project.) What would you like to do next? steel production growth1) Between 1900 and 2006, total world steel production (increased / decreased)2) In 2006, the United States produced (more / less) steel than it did in 1900.3) In 1900, (north america / asia / europe) had more steel-producing countries than other continents.4) In 2006, the worlds leading steel producers were located in (north america / asia / europe) BEFORE(my feelings during the pandemic/disaster)AFTER(my feelings right now) 14) Which of the following correctly shows the markings for a perpendicular bisector? How does the approximate number of atomsin the air in your lungs compare to the num-ber of breaths of air in the atmosphere of thewhole world? I dont understand what this is asking... i dont get why everybody hates red A ball held 2.0 meters above the floor has 59 joules of potential energy. The balls mass the answer3