who is ultimately responsible for decisions and policies that are made in a democracy such as the united states: the people or their elected representatives? why is it important to examine how economic influences affect the political process in the united states and other nations?

Answers

Answer 1

In a democracy like the United States, elected representatives are responsible for making decisions and policies on behalf of the people.

However, it is important to note that the ultimate power still rests with the people as they have the ability to vote their representatives out of office if they disagree with their decisions.

Examining how economic influences affect the political process is crucial because economic interests often shape political decisions. Large corporations and wealthy individuals can have significant influence over elected officials through campaign donations and lobbying efforts.

This can lead to policies that prioritize the interests of the wealthy over the needs of the majority of the population. By understanding how economic influences impact the political process, citizens can make more informed decisions when choosing their representatives and advocating for policies that benefit the entire population.

For more such questions on democracy

https://brainly.com/question/3710021

#SPJ11


Related Questions

The process of tracking the evolution development and sequence of critical events that affects the survival and profitability of the future new business is called?

Answers

The process you are referring to is called business forecasting.

Business forecasting is the practice of analyzing past and current data to make predictions about future business performance. It involves tracking the evolution, development, and sequence of critical events that could impact the success of a new business.

By forecasting trends and potential challenges, entrepreneurs can make informed decisions about their business strategy and operations.

Business forecasting can help entrepreneurs identify potential risks and opportunities, optimize resource allocation, and make adjustments to their plans as necessary. Ultimately, successful business forecasting can help new businesses survive and thrive in a competitive market.

To know more about business forecasting click on below link:

https://brainly.com/question/28547344#

#SPJ11

Based on the illustration showing freed people with union army soldiers what assumption is the artist making about the effects


of the Emancipation proclamation

Answers

The artist is assuming that the Emancipation Proclamation led to the freedom of enslaved people, who found protection and support from Union Army soldiers.

The illustration depicts freed people alongside Union Army soldiers, suggesting that the artist believes the Emancipation Proclamation played a significant role in granting freedom to formerly enslaved individuals.

The presence of the soldiers implies that they provided assistance and security to these newly freed people, reflecting the artist's assumption that the proclamation facilitated their liberation and transition to a new life.

The image may also represent a sense of unity and collaboration between the freed people and the Union Army, further emphasizing the impact of the Emancipation Proclamation in fostering positive change during the Civil War era.

To know more about Emancipation Proclamation click on below link:

https://brainly.com/question/29788953#

#SPJ11

Luiz is being asked to remember a series of the following 15 letters: FOXHOWLSWANTBUG. He finds this to be easier to remember as the four words "fox howls want bug. Rather than 15 individual letters. Luiz has used a process known as


a. Maintenance rehearsal.


b. Long-term potentiation.


c. Recognition


d. Chunking


e. Eidetic imagery

Answers

The process Luiz used to remember the series of 15 letters as four words is called chunking. (D)

Chunking is a memory technique where information is organized into smaller groups or "chunks" to make it easier to remember. In this case, Luiz chunked the 15 letters into four words, which made it easier for him to remember.

Maintenance rehearsal is the process of repeating information over and over again to keep it in short-term memory.

Long-term potentiation is the process of strengthening neural connections in the brain to improve long-term memory. Recognition is the ability to identify previously encountered information. Eidetic imagery is the ability to vividly recall visual images in great detail.

In conclusion, Luiz used the chunking technique to remember a series of 15 letters by organizing them into smaller groups. This made it easier for him to remember and retrieve the information from his memory.(D)

To know more about long-term memory click on below link:

https://brainly.com/question/16009462#

#SPJ11

Do you believe that the motivation for helping behavior is more self-serving (egoism) or selfless (altruism)? (Explain your answer in detail)

Answers

Answer:Motivation for helping is often more altruistic than egoistic.

Explanation: People who volunteer their time and abilities to a good cause generally want to serve others altruistically.

Which statement best describes mendelian or complete dominance?.

Answers

Mendelian or complete dominance is a genetic principle where one dominant allele fully masks the effects of a recessive allele, resulting in the expression of the dominant trait in the offspring.

In Mendelian or complete dominance, the dominant allele is represented by a capital letter, while the recessive allele is represented by a lowercase letter. When two organisms with different alleles for a trait are crossed, the dominant trait appears in the offspring, effectively masking the recessive trait. This principle was first proposed by Gregor Mendel, a 19th-century Austrian monk, who studied the inheritance patterns in pea plants.

Mendel's Law of Dominance states that when two organisms with contrasting traits are bred, the offspring will inherit the dominant trait. In heterozygous organisms, where one dominant and one recessive allele are present, the dominant allele determines the organism's phenotype. However, if both alleles are recessive, the organism will express the recessive trait.

Complete dominance is one of several inheritance patterns, including incomplete dominance and codominance, which describe how different alleles interact to determine the phenotype of an organism. While complete dominance is a relatively simple inheritance pattern, it is important to remember that many traits in nature follow more complex inheritance patterns that involve multiple genes and environmental factors.

Know more about Dominant traits here:

https://brainly.com/question/30975137

#SPJ11

The ""argument culture"" is typically learned at an early age.

Answers

The argument culture refers to a societal trend in which individuals engage in combative and confrontational interactions in order to win an argument or prove their point.

This culture is typically learned at an early age, as children often observe and imitate the communication styles of their parents and other adults in their lives. Additionally, schools and other educational institutions may inadvertently reinforce this culture by emphasizing competition and the need to be right in academic and social settings. As a result, many individuals grow up believing that arguing and conflict are necessary and effective means of communication, rather than seeking understanding and compromise.
The "argument culture" refers to a societal tendency where individuals are more focused on debating, arguing, and engaging in confrontational communication rather than listening, understanding, and cooperating. This culture is typically learned at an early age through various sources, such as family, school, and media.
In the family setting, children may observe their parents or caregivers engaging in heated discussions, debates, or arguments, which can influence their own communication styles. They may learn that to be heard or assert their opinions, they need to engage in the argument culture.
At school, children may be encouraged to participate in debate clubs or competitive activities, where the goal is to win arguments and prove one's point. This can further reinforce the belief that arguments and confrontations are the best ways to communicate and resolve conflicts.
Finally, the media often portrays confrontational exchanges between politicians, celebrities, and other public figures, which can further perpetuate the argument culture. Children who grow up in this environment may see arguing as the norm and adopt this communication style as they mature.
To summarize, the argument culture is typically learned at an early age through various sources such as family, school, and media. This influences children's communication styles and their understanding of conflict resolution, often leading them to participate in confrontational and competitive interactions.

For more such questions on  argument culture , Visit:

https://brainly.com/question/26522802

#SPJ11

An older adult client reports the inability to remember the last time dreaming occurred when sleeping. which phase of sleep is being affected in this client

Answers

Elderly clients report being unable to recall their last dream during sleep. Rapid eye movement is being affected in this client .

In older people, the amount of time spent in REM sleep may decrease and the quality of REM sleep may be impaired. This reduces the frequency and intensity of dreams, which can lead to sleep disturbances and cognitive decline.

Note that not everyone remembers their dreams due to factors such as sleep quality, individual differences in brain activity, and medication use. As we age, our sleep patterns change and we tend to spend less time in REM sleep. This can lead to decreased dream recall and altered sleep patterns. However, there may be other factors that affect a patient's ability to remember their dreams, such as Certain medications or sleep disorders.

To know more about sleep disorder visit :

https://brainly.com/question/10266206

#SPJ4

After 5 years, select the TABLE tab and record the percentages of each month type. (Note: The table shows current populations of each month, not the number of captured moths. )

Answers

After 5 years, go to the TABLE tab and record the percentages of each month type. Note that the table displays the current populations of each month, not the number of captured moths.


This question is likely related to a scientific experiment or study involving moths. It seems that data has been collected over the course of 5 years, and the task at hand is to record the percentages of each month type based on the information displayed in a table.

The key point to note is that the table shows current populations of each month, rather than the number of captured moths. This means that the data reflects the number of moths that are currently present in a given month, rather than the number of moths that were captured during that month.

This distinction is important because it helps ensure that the data is interpreted correctly. For example, if the table showed the number of captured moths, it would be difficult to draw conclusions about the overall population size, since some moths may have been captured multiple times.

By recording the percentages of each month type based on current populations, researchers can better understand how moth populations are changing over time.

To know more about population size click on below link:

https://brainly.com/question/31262022#

#SPJ11

What does the suffragette-defaced penny reveal about life in england during that time period?.

Answers

The suffragette-defaced penny reveals that life in England during that time period was characterized by social unrest and the struggle for women's rights. It highlights the creativity and determination of the suffragettes in their fight for gender equality.

The suffragette movement was a powerful force in early 20th century England. Women from various social backgrounds came together to fight for their right to vote and participate in public life. The defaced penny, which had the phrase "Votes for Women" stamped across King Edward VII's face, was a symbolic act of protest against the monarchy and the government's denial of women's suffrage. This coin, and other acts of civil disobedience, were aimed at challenging the status quo and raising awareness of the suffragettes' cause.

The presence of such an artifact in circulation demonstrates the extent to which the suffragettes were willing to go to make their voices heard. They not only sought legal reform but also used innovative methods to capture the public's attention and provoke conversation about women's rights. The defaced penny serves as a reminder of the passion, resilience, and creativity of these early feminists, as well as the societal and political climate they operated in. It's a testament to their enduring impact on the fight for gender equality in England and beyond.

Know more about suffragette-defaced here:

https://brainly.com/question/29614686

#SPJ11

an individual who stomps angrily out of a restaurant after being kept waiting five extra minutes for a reserved table because they feel they are far too important to be kept waiting for so long may be exhibiting symptoms of

Answers

The individual exhibiting symptoms of Narcissistic Personality Disorder (NPD). People with NPD display a grandiose sense of self-importance, need for excessive admiration, and lack of empathy.

They may feel entitled to special treatment or privileges, feeling their time is more valuable than others’. The situation described hints that the individual has entitlement issues, thinking they should be allowed to cut line and avoid waiting as it would have been an inconvenience for them.

Other symptoms of Narcissistic Personality Disorder  could include an exaggerated show of anger and desire for revenge if ‘disrespected’ in any way. It is important to recognize these signs of NPD as early intervention can help manage this disorder.

To know more about Narcissistic Personality Disorder visit:

https://brainly.com/question/29577576

#SPJ4

how you have been subjected to subcultural practices.

Answers

One could be subjected to these subcultural practices through various means such as joining a specific social group or participating in a unique hobby or interest.

Being subjected to subcultural practices helps me understand diverse perspectives and adapt my responses accordingly.

Subcultural practices are specific behaviors, beliefs, and values shared by a group of people within a larger culture.

Some examples of subcultural practices include alternative fashion styles, unique forms of art, and distinct music genres.

By participating in their activities, learning their lingo, and adopting their clothing style, you are subjecting yourself to their subcultural practices.

As you continue to engage with this group, you'll gradually become more immersed in the subculture, and it will influence your behavior and identity. This process of adopting subcultural practices is called enculturation.

To know more about social group refer here :

https://brainly.com/question/2806237#

#SPJ11

____ knowledge is formal, systematic knowledge, whereas___ knowledge includes professional know-how,expertise, individual insight and experience

Answers

Explicit knowledge is formal, systematic knowledge, whereas Tacit knowledge includes professional know-how,expertise, individual insight and experience

Explicit knowledge refers to formal, systematic knowledge that can be easily articulated, documented, and shared with others. Examples include facts, data, and written procedures. On the other hand, tacit knowledge encompasses professional know-how, expertise, individual insight, and experience, which are more difficult to express and transfer. This type of knowledge is gained through personal experiences, often involving intuition and practical skills.

In summary, explicit knowledge is formal and easily shared, while tacit knowledge involves individual expertise and experience, making it more challenging to convey.

To know more knowledge visit:

https://brainly.com/question/14228542

#SPJ11

A sandwich cost $2.50 in 1982, what does it cost now with the cpi at 194.1? (assume that the sandwich price rose at the same rate as other prices in the index.)

Answers

The current cost of a sandwich, which was $2.50 in 1982, with the CPI at 194.1, is $6.48.

To find the current cost of the sandwich, we need to determine the change in the Consumer Price Index (CPI) since 1982 and apply that to the original price of the sandwich.

1. Determine the CPI in 1982. This information was not provided, so we will assume a 1982 CPI value of 100 for simplicity.
2. Calculate the CPI change: 194.1 (current CPI) - 100 (1982 CPI) = 94.1.
3. Find the inflation rate: (94.1 / 100) = 0.941 or 94.1%.
4. Apply the inflation rate to the 1982 sandwich price: $2.50 * (1 + 0.941) = $2.50 * 1.941 = $4.8525.
5. Round to two decimal places: $4.85.

With the CPI at 194.1, a sandwich that cost $2.50 in 1982 now costs $4.85, assuming the sandwich price rose at the same rate as other prices in the index.

To know more about Consumer Price Index click on below link:

https://brainly.com/question/4513076#

#SPJ11

the approach to motivation emphasizes the role of species-specific instincts in directing behavior. True or False

Answers

Answer:

False. The approach to motivation that emphasizes the role of species-specific instincts in directing behavior is known as the instinct theory, which has been largely discredited in modern psychology.

Explanation:

To assign overhead costs to an individual product, the activity-based overhead rate is multiplied by.

Answers

Assigning overhead costs to an individual product using activity-based overhead rates.

In order to assign overhead costs to an individual product, the activity-based overhead rate is multiplied by the number of activity units consumed by that particular product. This method is known as Activity-Based Costing (ABC), which aims to more accurately allocate indirect costs to products by considering the specific activities that drive those costs.

Activity-based overhead rates are calculated by dividing the total overhead costs of each activity by the total number of activity units. An activity unit is a measure of how much of a particular activity is used by a product. Examples of activity units can include machine hours, labor hours, or production runs, depending on the type of cost driver involved.

Once the activity-based overhead rates are determined, they can be applied to individual products by multiplying them with the number of activity units consumed by each product. This results in a more precise allocation of overhead costs, which can help businesses better understand the true cost of their products and make more informed decisions regarding pricing, production, and profitability.

In summary, assigning overhead costs to an individual product involves calculating activity-based overhead rates and then multiplying those rates by the number of activity units consumed by the product. This approach provides a more accurate representation of product costs and helps businesses make better strategic decisions.

Know more about "Activity-Based Costing".

https://brainly.com/question/24009922

#SPJ11

Based on your answer to the previous question, what contribution to world exploration was made by this explorer?

Answers

The answer to the previous question mentioned Christopher Columbus as the explorer in question. Columbus is credited with discovering America in 1492, although it is important to note that indigenous peoples were already living there.

His voyages across the Atlantic Ocean opened up European exploration and colonization of the Americas, which had significant historical and cultural consequences.

Traveling for the purpose of discovery or education about new geographic, scientific, cultural, or other information is referred to as exploration. In order to gather information, make contact with new people and cultures, or deepen knowledge and understanding of the world, it frequently entails traveling to distant or uncharted locations. From the early exploration of the world's oceans and landmasses to space exploration and the search for extraterrestrial life, exploration has played a significant role in human history.

To know more about exploration here

https://brainly.com/question/13335713

#SPJ4

in which of these countries is french an official language?

Answers

Countries where French is an official language are France, Belgium, Switzerland, and Luxembourg (European countries).

Outside of Europe, French is an official language in several African countries, including Algeria, Benin, Burkina Faso, Burundi, Cameroon, Central African Republic, Chad, Comoros, Congo, Ivory Coast, Democratic Republic of the Congo, Djibouti, Equatorial Guinea, Gabon, Guinea, Madagascar, Mali, Mauritania, Mauritius, Morocco, Niger, Rwanda, Senegal, Seychelles, Togo, and Tunisia.

French is also an official language in Canada, particularly in the province of Quebec, and in Haiti, which shares the island of Hispaniola with the Dominican Republic.

Overall, French is an important language with significant global reach, and its status as an official language in multiple countries reflects its historical, cultural, and political significance.

To know more about French refer here :

https://brainly.com/question/30175980#

#SPJ11

A newly exposed surface of metallic sodium tarnishes almost instantly if exposed to air and moisture, while iron will slowly turn to rust under the same conditions. In these two situations. What does it refer when reactants change into products quickly or slowly?

Answers

The process of reactants changing into products quickly or slowly is referred to as the rate of reaction. The rate of reaction is the speed at which reactants are consumed and products are formed during a chemical reaction.

In the case of metallic sodium and iron, both are metals that are susceptible to corrosion when exposed to air and moisture. However, the rate at which they corrode is different. Metallic sodium tarnishes almost instantly when exposed to air and moisture, while iron takes a longer time to rust under the same conditions.

This difference in the rate of reaction can be attributed to various factors, including the nature of the reactants, temperature, concentration, and the presence of catalysts. For example, metallic sodium reacts very vigorously with water, producing hydrogen gas and sodium hydroxide. The reaction is so fast that it can result in an explosion if not controlled properly. On the other hand, rusting of iron is a slower process that involves the gradual oxidation of iron in the presence of moisture and air.

Know more about catalysts here:

https://brainly.com/question/24430084

#SPJ11

what incited the various sit-ins and protests at columbia university? how would you describe the makeup of these protestors and what ultimately happened to them? do you think that anything of this size and nature could happen today? why or why not?

Answers

The various sit-ins and protests at Columbia University were sparked by the university's plans to build a gymnasium in a nearby public park.

The protestors were primarily students, along with some faculty and community members.

The protests led to numerous arrests, and in the end, the university abandoned its plans to build the gym. It is possible that something of this size and nature could happen today, as many students and faculty are still passionate about social justice issues and are willing to take a stand. However, today's protests are more likely to be held online or through other virtual means, rather than in-person demonstrations.

To know more about Columbia University, click here:

https://brainly.com/question/547074

#SPJ4

How is climate crisis politics in the us right now? What are some big current issues we are facing.

Answers

The politics of climate crisis in the US are complex and multifaceted, with a wide range of stakeholders and competing interests involved. However, the urgency of the crisis is increasingly driving action and mobilization from a diverse array of actors, including activists, scientists, businesses, and policymakers.

One of the biggest current issues facing the US in terms of climate crisis politics is the need to reduce greenhouse gas emissions and transition towards clean energy sources.

This has been a major topic of debate in recent years, with many policymakers and activists advocating for policies that would promote the use of renewable energy and phase out fossil fuels. However, there is also significant opposition to these efforts from the fossil fuel industry and their allies in government.

To know more about climate issues:

https://brainly.com/question/5826500

#SPJ1

Question 8 of 10
Which statement best illustrates an example of economic specialization?
A. An artist becomes an expert at designing websites for
restaurants.
B. An employee leaves a large corporation to start her own business.
C. A country decides to stop importing goods from foreign
companies.
D. A business owner only hires employees with a wide variety of
skills.

Answers

Answer: A. An artist becomes an expert at designing websites for restaurants.

At first glance, this role is not that obvious. after all, a price is just a number, so how can it possibly transfer any information? indeed, who is transferring this information and to whom?

Answers

At first glance, the role of a price may not seem obvious, as it is simply a numerical value assigned to a product or service. However, prices play a crucial role in transmitting information to both consumers and producers in the market. Prices serve as signals for the availability and demand of goods and services. For example, if a product is in high demand and there is limited supply, the price will increase, signaling to producers to increase production and for consumers to adjust their consumption patterns.

Additionally, prices also serve as a means for resource allocation. Prices allocate resources to their most valued uses and indicate the opportunity cost of producing a particular product or service. If the cost of producing a certain product exceeds its price, then it is not profitable for producers to continue producing it.

Furthermore, prices also transmit information about the quality of goods and services. Higher prices are often associated with higher-quality products, and consumers are willing to pay more for those products. Thus, prices not only serve as a signal for availability and demand, but also as an indicator of quality.

Overall, the role of prices may not be obvious at first glance, but they serve as crucial signals in transmitting information to both producers and consumers in the market. They facilitate resource allocation, signal availability, and demand, and indicate the quality of goods and services.

Know more about consumption patterns here:

https://brainly.com/question/29788550

#SPJ11

2. How does the idea of American exceptionalism relate to the concept of manifest destiny in the text? *

Answers

The idea of American exceptionalism relates to the concept of manifest destiny as they are interconnected in American history, both reflect a belief in the unique and superior nature of the United States and its role in the world.

American exceptionalism refers to the belief that the United States is a unique and superior nation, with a special destiny to lead the world.

Manifest destiny, on the other hand, is the belief that it was the God-given right and duty of the United States to expand its territory and spread its values across the North American continent.

The idea of American exceptionalism was used to justify and promote the concept of manifest destiny in the 19th century. Many Americans believed that their country had a unique mission to spread democracy, Christianity, and civilization across the continent.

They saw the expansion of American territory as a natural and necessary part of this mission, as well as a way to demonstrate the superiority of American institutions and culture.

The concept of manifest destiny played a significant role in shaping American foreign policy, particularly in the 19th century. It fueled westward expansion, the acquisition of new territories, and the displacement of Native American populations.

It also contributed to the belief in American imperialism and the idea that the United States had a right to assert its dominance over other nations.

To know more about American exceptionalism refer here :

https://brainly.com/question/30811386#

#SPJ11

Girls who were exposed to the male hormone _____ before birth were more likely to play with toys stereotypically preferred by boys.

Answers

Girls who were exposed to the male hormone testosterone before birth were more likely to play with toys stereotypically preferred by boys.

Exposure to testosterone in the womb can influence a child's behavior and preferences. In the case of girls exposed to higher levels of testosterone before birth, studies have shown that they tend to show more interest in toys that are traditionally associated with boys, such as trucks and building blocks.

This may be due to the fact that testosterone plays a role in shaping brain development, influencing areas related to interests and activities.

As a result, these girls may gravitate toward activities and preferences that are typically associated with boys, demonstrating the impact of prenatal hormone exposure on later behavior and preferences.

To know more about testosterone click on below link:

https://brainly.com/question/30846493#

#SPJ11

In some native american tribes, there is a disorder called __________, which is when the individual experiences violent or aggressive outbursts of which they have no memory. a. amok b. zar c. taijin-knofu-sho d. anorexia nervosa please select the best answer from the choices provided a b c d

Answers

In some native american tribes, there is a disorder called  amok, which is when the individual experiences violent or aggressive outbursts of which they have no memory. (A)

This disorder is also known as "running amok" and is characterized by sudden and unprovoked episodes of violence or aggression, during which the individual may harm others or themselves.

They may also have no memory of the event afterwards. Amok is a rare and culturally specific disorder that is believed to have a strong genetic and environmental component.

It is important to note that the term "amok" has been used historically as a racial stereotype and it is important to approach the disorder with sensitivity and respect for the affected communities.(A)

To know more about racial stereotype click on below link:

https://brainly.com/question/22165687#

#SPJ11

Critically discuss "politics as compromise and consensus" with reference to chechnyan and russian wars, ethiopia and eritrea conflict as well as sudanese war.

Answers

Politics is often viewed as a process of compromise and consensus, where conflicting interests are resolved through negotiation and agreements. The Chechen and Russian wars, the Ethiopia and Eritrea conflict, and the Sudanese war are examples of conflicts that have defied the logic of compromise and consensus.

In the case of the Chechen and Russian wars, compromise and consensus were almost impossible due to the long-standing animosity between the two sides. Chechens had long fought for independence, but Moscow viewed the region as an integral part of Russia. Negotiations were attempted, but they failed to address the core issues. Eventually, the conflict was resolved through force, with Russia regaining control over Chechnya.

Similarly, the Ethiopia and Eritrea conflict was characterized by a lack of compromise and consensus. The two countries fought a bloody border war in 1998-2000 that claimed thousands of lives. Despite international mediation efforts, the conflict remained unresolved until 2018. The lack of compromise and consensus was fueled by historical and territorial claims, as well as political and economic interests.

The Sudanese war is another example of the limits of compromise and consensus. The conflict between the government and rebel groups in Darfur and South Sudan has claimed hundreds of thousands of lives and displaced millions of people. Negotiations have been attempted, but they have been hampered by mistrust, ideological differences, and power struggles.

In conclusion, while politics as compromise and consensus can be effective in resolving conflicts, it is not a panacea. In many cases, historical, territorial, and political factors make it difficult to reach agreements. The conflicts in Chechnya, Ethiopia, Eritrea, and Sudan illustrate the limits of this approach.

Learn more about Consensus: https://brainly.com/question/29372377

#SPJ11      

     

List the 10 major events leading to the french revolution

Answers

Answer:

Meeting of the Estates General

Fall of the Bastille

March on Versailles

Flight to Varennes

Dissolution of the National Assembly

War

Attack on the Tuileries Palace

Declaration of the Republic and the Trial of Louis

Reign of Terror

Directory and the Rise of Napoleon

Explanation: brainliest please?

I. state true or false.
1. one of the ways to practice conservation is to refuse to use a resource even when we need it.
2. potential resources are those resources that can be further developed and put to use in the
future.
3. a resource like natural gas cannot be recycled.
4. metallic minerals are examples of renewable resources.
5. human beings depend on natural resources only for food.
ii. complete the analogy.
1. petroleum:______________: forests: renewable resource
2. human beings: biotic resource:: soil:_______________
3. iron-ore:________________:: bio-waste: potential resource

Answers

I. state true or false.


1. One of the ways to practice conservation is to refuse to use a resource even when we need it- False.

Refusing to use a resource even when we need it is not a practical way to practice conservation. Conservation means making the best use of resources while minimizing waste and damage to the environment.


2. Potential resources are those resources that can be further developed and put to use in the future-True.

Potential resources are those resources that exist in nature but are not yet fully developed or utilized. For example, renewable energy sources like wind and solar power have immense potential and can be further developed to meet our energy needs.


3. A resource like natural gas cannot be recycled- False.

Natural gas can be recycled, although it is not a renewable resource. It is a fossil fuel that can be extracted from underground reserves and processed for various uses like heating, cooking, and electricity generation.


4. Metallic minerals are examples of renewable resources- False.

Metallic minerals are not renewable resources. They are formed by geological processes and are finite in quantity. Once they are extracted and used, they cannot be replaced. Examples of renewable resources are solar, wind, hydro, and geothermal energy sources.


5. Human beings depend on natural resources only for food-False.

Human beings depend on natural resources not only for food but also for various other needs like shelter, clothing, medicine, and transportation. Natural resources include air, water, soil, minerals, forests, wildlife, and marine life.

II. complete the analogy.

1. Petroleum: Non-renewable resource: Forests: Renewable resource.

Petroleum is a fossil fuel that is formed by the decomposition of organic matter over millions of years. It is a non-renewable resource because it takes a long time to form and cannot be replenished at the same rate as it is consumed. Forests, on the other hand, are a renewable resource because they can regrow after they are harvested or cleared. They provide various ecosystem services like carbon sequestration, soil conservation, and biodiversity.


2. Human beings: Biotic resource: Soil: Abiotic resource.

Human beings are a biotic resource because they are living organisms that can contribute to the economy and society. Soil, on the other hand, is an abiotic resource because it is a non-living component of the earth's crust. It is essential for plant growth and supports various ecosystem services like nutrient cycling, water regulation, and habitat for soil organisms.


3. Iron-ore: Non-renewable resource: Bio-waste: Potential resource.

Iron ore is a non-renewable resource because it is a mineral that is extracted from the earth's crust and cannot be replenished at the same rate as it is consumed. It is used to make steel, which is a vital material for construction, transportation, and manufacturing. Bio-waste, on the other hand, is a potential resource because it can be converted into useful products like compost, biogas, and biofuels. It includes organic waste materials like food scraps, yard waste, and agricultural residues. By recycling bio-waste, we can reduce waste disposal, greenhouse gas emissions, and reliance on non-renewable resources.

Know more about natural gas here:

https://brainly.com/question/12200462

#SPJ11

which statement describes the type of crisis experienced when the father of the bride gets killed in a motor vehicle accident on the way to a wedding; the bride is this grieving, and her 34-year-old groom is waiting on the bride and does not realize what has happened? select all that apply.one, some, or all responses may be correct.

Answers

This is a tragic and unexpected crisis. The bride is faced with the sudden loss of her father, and is likely grieving deeply.

The groom, who is waiting on the bride, is unaware of what has happened and is likely expecting her to arrive. This is an emotionally and psychologically devastating situation, as the bride has been faced with the sudden loss of a loved one and the groom is in a state of confusion and uncertainty.

This type of crisis is a critical and emotionally-charged one with potentially long-term repercussions for those involved. It is important for those affected to be given the support, care, and space to process and grieve in a healthy way.

To know more about psychologically , click here:

https://brainly.com/question/31197260

#SPJ4

Why was the Colossus built?


a It was a warning to anyone who wanted to invade the Island of Rhodes


b It was a symbol of unity for the people of Rhodes and way to thank the Gods for a victorious battle


c It was the final resting place for a great leader of Rhodes


d Every four years athletes would compete in a serious of contest and they would make sacrifices to the statue so they could preform well

Answers

The Colossus was built as a symbol of unity for the people of Rhodes and a way to thank the Gods for a victorious battle.(B)

The Colossus of Rhodes, a massive statue of the sun god Helios, was constructed to celebrate the island's victory over an invading force from Cyprus. After the battle, the people of Rhodes wanted to demonstrate their gratitude to the Gods and promote unity among their citizens.

The statue was not only a symbol of their triumph, but it also represented their shared devotion to Helios and their collective strength as a united people. Contrary to other options, it was not a warning, a leader's resting place, or related to athletic competitions.(B)

To know more about Cyprus click on below link:

https://brainly.com/question/857429#

#SPJ11

Other Questions
A spotlight is mounted on the eaves of a house 20 feet above the ground. A flower bed runs between the house and the sidewalk, so the closest the ladder can be placed to the house is 15 feet. How long a ladder is needed so that an electrician can reach the place where the light is mounted If f(x) is defined as follows, find (a) f(-3), (b) f(0), and (c) f(4).xif x < 0if x = 03x + 3 ifx>0f(x) = 0(a) f(-3)= (Simplify your answer.)THE The operating system is not presently configured to run this application. A pressure switch is used in a washing machine to control the flow of water. The water pushes on a flexible container and compresses some trapped air. When the pressure of this trapped air reacher 104 kPa, the pressure switch turns the water off. The pressure of the trapped air is given by this relationship: pressure of the trapped air - atmospheric pressure + pressure difference caused by the water. Calculate the height of water in the machine when the pressurre of the trapped air reaches to 104 kPa and the switch operates. (atmospheric pressure = 100 kPa, density of water = 1000 kg/m^3) How to find out if a solid, more specifically powdered cement, is acid or alkali? Between 1940 and 1955, the average income for a u.s. family tripled. this was likely the result of- reduced unemployment - the expansion of corporations & creation of more white-collar jobs- all of these choices are correct- more women entering the workplace A car repair shop specialises in exhaust pipe replacement. Every year it costs $34,800 to rent the shop and maintain their equipment and $50,000 to pay their employees. For every exhaust pipe replaced the repair shop charges the customer the price of the parts required plus $248 as a service charge. How many exhaust pipe replacements does the repair shop need to complete in order to break even? 4. Calculate and properly express the 2017 accounts receivable turnover ratio for OReilly Auto Parts. ASSUME ALL SALES REPRESENT CREDIT SALES. (6 pts)8,977,726/216,251+197,274/2 = 8,977,726/206762.5 = 43.4 times Answer: 43.4 times5. Calculate and properly express the 2017 (fiscal year ended August 26, 2017) accounts receivable turnover ratio for AutoZone. ASSUME ALL SALES REPRESENT CREDIT SALES. (6 pts)10,888,676/280,733+287,680/2 = 10,888,676/284206.5 = 38.3 timesAnswer: 38.3 times6. Calculate and properly express the average collection period for each company. (6 pts)OReilly Auto Parts: 365/43.4 = 8.4 daysAutoZone: 365/38.3 = 9.5 daysAnswer: OReilly Auto Parts: 8.4 daysAutoZone: 9.5 days7. Which company has a better receivable turnover ratio and why? Explain in three complete sentences. (4 pts)8. Calculate and properly express the 2017 inventory turnover ratio of OReilly Auto Parts. (6 pts)4,257,043/3,009,800+2778,976/2 = 4,257,043/2,894,388 = 1.5 timesAnswer: 1.5 times9. Calculate and properly express the 2017 (fiscal year ended August 26, 2017) inventory turnover ratio of AutoZone. (6 pts)5,149,056/3,882,086+3,631,916/2 = 1.4 timesAnswer: 1.4 times10. Calculate the average days to sell inventory for each company. (6 pts)OReilly Auto Parts: 365/1.5 = 243.3 daysAutoZone: 365/1.4 = 260.7 days Answer: OReilly Auto Parts: 243.3 daysAutoZone: 260.7 days11. Which company has a better inventory turnover ratio? (2 pts) Why, what does this ratio represent? Explain in a short paragraph. (4 pts)I need a answer for n 7 and 11 Which of the following examples of figurative language from the poem best supports the idea that Susan B. Anthony was ahead of her time?A.On ground hard held to the last, gaining her goal for womenB. Her life is a luminous banner bome ever ahead of her eraC. Her spirit like southern starlight at once is afar and around usD. In the mine, the mill and the mart where is bartered the bread of your children At what condition do magnesium chloride and silver nitrate react? this is due now !!!!!!!! 98. How many start codons are there?99. How many stop codons are there?100.101. The process of translation takes place in the102. Replication and Transcription both take place in theSecond baseFirst baseUGUUUUUCUUAUUGCUUCUCCUACUGsignals the end of the process ofGUUGUCGUAGUGlek ne(LewAUUAUCAUAAUG theone (Met)(ke)ne(Val)UCUUCCUCAUCGCCUCCCCCACCGACUACC theACA(MhviACGGCUGCCGCAGCGAlaUAUUACUAAUAGAAUAACCAU histidineCACCAACAG6AAAAAGGAUGACtyfouneGAAGAGSTOPgutamineof the cell.(Avilboneof the cell.UGUUGCUGAUGG tryptophan (1)CGUCGCCGACGGAGUAGCAGAAGGpart and GGUGGOGGAGGGKVMargune(Arg)(Gly)DYSCU3Third baseGC A museum sells stone souvenirs shaped like a cone with a diameter of 4.2 centimeters and a height of 9.5 centimeters. What is the volume of each souvenir? Round to the nearest tenthPLEASE HURRY Determine the measure of arc cad thanks grade 9-10-11 it is either 240 or 260 Basic body color for wolves is influenced by several genes, one of which has several different alleles. Two of these alleles-white coat and black coat-display incomplete dominance. A wolf is heterozygous for these two alleles displays a gray coat. Is it possible to produce a line of pure-breeding gray wolves? Why or why not?Incomplete dominance: blended traits IreadyHow were adventure playgroundsof the 1960s different fromplaygrounds of the 1920s? If your starting salary is $50,000 and you receive a 4% increase at the end ofevery year, what is the total amount, in dollars, you will earn over the first 16years that you work?Round your answer to the nearest whole dollar, and express your answerwithout using commas.Answer hereSUBMIT 13. If the supply of gasoline rises, name a substitute that will increase in demand? 14. How do you think each of the following affected the world price of oil? List if it will effect supply or demand, and the price change if any. Use basic supply and demand analysis. a. Tax credits were offered for expenditures on home insulation. b. The Alaskan oil pipeline was completed. c. Oil was discovered in Mexico and the North Sea. d. Sport Utility Vehicles and minivans became popular. e. Natural oil reserves became depleted Which is the BEST way to distribute aerobic activity throughout the week? one long session in a single day two equally long sessions separated by several days several equally long sessions spread over the week. several equally long sessions in one or two days Explain the key differences (not just the definitions) between the four functional areas of theorganization. Also, explain why we need all four areas for a business to prosper.