who were the german social democrats and what is the significance of november 11 1918

Answers

Answer 1

The German Social Democrats were a political party that emerged in the late 19th century and represented the interests of the working class in Germany. They advocated for social and economic reforms and played a major role in shaping German politics in the early 20th century.

November 11, 1918, marked the end of World War I and the beginning of a new era in German history. On that day, German Social Democrats declared the establishment of a democratic republic, marking the end of the German Empire and the rule of the Kaiser. This event is significant because it led to a period of political turmoil and instability in Germany, as various political factions vied for power in the new republic. The Social Democrats played a key role in the early years of the Weimar Republic, but the government ultimately fell to the rise of the Nazi party in 1933. Nevertheless, the legacy of the Social Democrats and their commitment to democratic values continues to influence German politics today.

Learn more about the World War:

brainly.com/question/1449762

#SPJ4


Related Questions

Question 5 of 10
A high level of productivity means that a worker:
OA. works in a career with a lot of competition.
OB. is a member of a worker organization.
O C. creates a lot of something quickly.
OD. has skills that are worth a lot of money.
SUBNET

Answers

Answer:

OD. IT MEANS THAT A PERSON IS WELL SKILLED AND ORGANISED

the new deal attempted to revive the farm economy during the 1930’s by

Answers

 The New Deal was a series of policies and programs implemented by President Franklin D. Roosevelt between 1933 and 1939 to help lift the United States out of the Great Depression.

One of the main goals of the New Deal was to revive the farm economy, which had been hit particularly hard by the crisis. The Agricultural Adjustment Act (AAA) of 1933 was the first significant New Deal measure to help farmers. It established the Agricultural Adjustment Administration (AAA), which sought to stabilize farm incomes by increasing crop prices and reducing production. The AAA also authorized the government to buy and slaughter excess livestock, as well as to pay farmers to take land out of production.

The Farm Credit Act of 1933 established a system of government-owned lending institutions to provide farmers with credit for planting and operating their farms. The Soil Conservation and Domestic Allotment Act of 1936 authorized the government to buy, store, and distribute farm produce, and the Bankhead-Jones Farm Tenant Act of 1937 provided federal funding for projects that helped tenant farmers. Additionally, the National Industrial Recovery Act of 1933 provided financial support for rural areas, and the Social Security Act of 1935 provided old-age pensions to rural workers. All of these measures helped stabilize the farm economy and restore the fortunes of struggling farmers.

For such more questions on new deal :

brainly.com/question/1286663

#SPJ11

Several states refused to ratify the Constitution unless:

Amendment 1 was added

The Bill of Rights was added

The Magna Carta was added

The Judiciary was removed

Answers

hope this helps. btw i need brainliest to level up

the answer is b) the bill of rights was added

explanation: many states and anti federalists feared that the new national government would be too powerful and thus threaten individual liberties, given the absence of a bill of rights. so they refused to ratify unless they had written and approved laws guaranteeing personal rights and freedoms.

what unintended consequence did john adams’s plan to appoint midnight judges lead to?

Answers

For the first time in history, the Court did this in Marbury by invalidating a portion of the Judicial Act of 1789. Unexpected outcomes came from the solution to the midnight judges' dilemma.

The Federalists were defeated as a result of the judges Adams appointed being unable to occupy their positions. Adams appointed the "midnight judges" to swiftly fill any open court positions with defenders of Adams and the Federalist Party. In order to appoint political sympathisers to the judiciary, the Federalist Party and their congressional allies wanted the act to be passed as soon as possible.

To know more about Judicial, click here:

https://brainly.com/question/27501748

#SPJ4

Reconstruction - The period following the passed laws designed to bring the Problems faced by Virginians during Reconstruction Millions of freed African Americans needed • (1) bom (2) • Virginia's economy was in ruins: had no value. Banks were Cloc taily ads, bridges were destroyed. ● states back into the Measures taken to resolve problems • The Fed s in which the country and S (3) Tel (4) dicas (5) cleting Crops and Creps and built provided (1) home Bukau was a government agency that and (3) Jobs do thi (2) Lood for freed African Americans and others in Virginia. shade cloring was a system common in Virginia after the war in which fod men's and poor white landowner by promising to pay the owner with a share of the Cop rented land from a​

Answers

The Feds improved the economy of Virginia during Reconstruction by establishing the Freedmen's Bureau to provide assistance to freed African Americans, implementing sharecropping to increase agricultural production and providing income to the poor, and investing in building and repairing infrastructure.

How did the Feds improved the economy of Virginia during Reconstruction Period?

During the Reconstruction period, Virginia's economy was in ruins, with its banks having no value and its infrastructure heavily damaged. The government agency known as the Freedmen's Bureau was established to provide assistance to the millions of freed African Americans who needed homes and jobs.

The Feds also implemented a system called sharecropping, which provided land to freed African Americans and poor white landowners by promising to pay the owner with a share of the crops collected. This system helped to increase agricultural production and provided income to those who were previously without work. Finally, the Feds invested in building and repairing infrastructure such as roads, bridges, and railways, which helped to improve transportation and stimulate economic activity in the state.

Read more about Reconstruction

brainly.com/question/13753522

#SPJ1

which of the following provides the best justification for rationing?
A The U.S. government needed funds to pay for the war
B. More men were needed in the military
C. Food and other resources were limited to prevent shortages
D. Women were needed in the workforce to replace the men fighting in the war

Answers

C. Foods and other resources were limited to prevent shortages

how did the missouri compromise of 1820 end the crisis over representation in congress?

Answers

This legislation simultaneously accepted Maine as a non-slave state and Missouri as a slave state to maintain the country's balance between slave and free states. In the remaining Louisiana Territory, above the 36° 30' latitude line, slavery was likewise prohibited.

The long-standing ratio of the number of slave states to the number of free states would be altered with the acquisition of the Louisiana Territory and the application of Missouri for statehood. The subject of slavery caused controversy inside Congress.

To maintain a balance between slave and free states across the nation, Congress passed this legislation and simultaneously accepted Maine as a non-slave state and Missouri as a slave state.

To know more about Slavery click here

https://brainly.com/question/9030828

#SPJ4

which of the following accurately indicates the process by which the slave trade was ended in the north atlantic? group of answer choices the united states was the first north atlantic power to prohibit the slave trade, and others followed its lead. countries gradually prohibited the slave trade, and britain posted a naval squadron off the coast of west africa to prevent any slave trade north of the equator. european and american revolutionaries all agreed that free wage labor was inherently more productive than forced labor. the dutch persuaded the french and other european governments to prohibit the slave trade.

Answers

The process by which the slave trade was ended in the North Atlantic was that countries gradually prohibited the slave trade, and Britain posted a naval squadron off the coast of West Africa to prevent any slave trade north of the equator.

What was the process by which the slave trade was ended in the North Atlantic?

The slave trade in the North Atlantic was ended by countries gradually prohibiting the slave trade, and Britain posted a naval squadron off the coast of West Africa to prevent any slave trade north of the equator.

There were different reasons that led to the prohibition of the slave trade by different countries. American and European revolutionaries agreed that free wage labor was more productive than forced labor. They believed that free wage labor led to economic growth and industrialization.

In contrast, forced labor was seen as an inefficient economic system that perpetuated poverty, exploitation, and underdevelopment. Therefore, the abolition of slavery was seen as a way to promote economic growth and prosperity.

The Dutch persuaded the French and other European governments to prohibit the slave trade. The Dutch were influential in European politics and used their diplomatic skills to lobby for the abolition of the slave trade. They used their economic power and influence to persuade other European countries to join the abolitionist movement.

In conclusion, the slave trade in the North Atlantic was ended by different countries prohibiting it, and Britain posting a naval squadron off the coast of West Africa to prevent any slave trade north of the equator.

The abolition of slavery was seen as a way to promote economic growth and prosperity. The Dutch played a crucial role in persuading other European countries to join the abolitionist movement.

To know more about slave trade refer here:

https://brainly.com/question/8667023#

#SPJ11

What specific events from his rebellion stand out to you and why?​

Answers

Numerous African Americans were lynched following the rebellion, though many of them did not take part in it.

What transpired during Nat Turner's revolt?

Turner and his followers started at his master's house on August 21, 1831, at 2:00 a.m., killing the entire family. They marched through Virginia's Southampton County, where they killed at least 55 people before being crushed by white authorities. Before being apprehended, Turner evaded capture for nearly two months.

Numerous African Americans were lynched following the rebellion, though many of them did not take part in it. Turner was only captured at the end of October, and he was tried, found guilty, and given the death penalty after freely admitting his part in the bloodshed.

To learn more about rebellion visit :

https://brainly.com/question/13938004

#SPJ1

In the 1930s Japanese nationalists sought to correct the ill effects of the Great Depression by employing which actions?
A. by negotiating trade agreements
B. by expanding democratic principle
C. by adopting free-market capitalism
D. by seizing foreign territories with valuable resources

Answers

In the 1930s, Japanese nationalists sought to correct the ill effects of the Great Depression by employing the action of seizing foreign territories with valuable resources. The correct option is option D.

The Great Depression was an economic downturn that lasted from 1929 to 1939 and affected the entire world. It was a time of severe unemployment and an increase in the number of people living in poverty, with no significant economic activity happening across the globe. A substantial percentage of the world's population was affected as banks closed, factories and farms stopped producing, and unemployment rates skyrocketed.

During the 1930s, the Japanese nationalists attempted to correct the ill effects of the Great Depression by employing the action of seizing foreign territories with valuable resources. The Japanese nationalists pursued an aggressive foreign policy in the hopes of acquiring resources to fuel their military and economic growth.

They believed that by taking over other countries' resources, they could restore Japan's economic growth and improve the livelihoods of the Japanese people. The Japanese attack on China in 1937 and later the Pacific War in 1941 were both motivated by this aggressive foreign policy.

To know more about Great Depression, refer here:

https://brainly.com/question/29771180#

#SPJ11

Issuing licenses is an example of which type of power?

A. Reserved
B. Inherited
C. Delegated
D. Concurrent

Answers

Answer:

A) reserved powers

Explanation:

Some examples of reserved powers are the power to create an education system and the power to issue driver's licenses.

excavation in northern montana (with help from the blackfoot tribe) found evidence of a hunting practice used for thousands of years in. this site was a:

Answers

Excavation in northern Montana (with help from the Blackfoot tribe) found evidence of a hunting practice used for thousands of years in a site that was a: hunting ground.

What is excavation?

Excavation is the methodical and scientific excavation of archaeological sites or finds to uncover and record the physical and cultural features that reveal the human past. Excavation may be the initial stage of archaeological research, but it is not synonymous with the study of archaeology.

Learn more about excavation at

https://brainly.com/question/27447995

#SPJ11

what best describes students for a democratic society? responses a 1960s student organization that opposed the war a 1960s student organization that opposed the war a conservative student group within the republican party a conservative student group within the republican party a group of congressional interns a group of congressional interns an organization of rotc students an organization of , r o t c, students

Answers

Students for a Democratic Society was a 1960s student organization that opposed the war. Therefore the correct option is option B.

The SDS did not support violence, and it was committed to nonviolence. However, the organization gained a reputation as a violent group due to its association with radical groups, and the organization was disbanded in 1969.

The Weather Underground was a splinter group of the SDS that formed in the 1970s and used violence to accomplish its goals. The SDS was a prominent student organization that opposed the Vietnam War and advocated for social and political change in the United States.

So, "a 1960s student organization that opposed the war" best describes students for a democratic society. Therefore the correct option is option B.

For such more question on Democratic:

https://brainly.com/question/3710021

#SPJ11

A monument featuring scenes from the last judgment, a vision of the apocalypse, the rising of the dead is typical for?

Answers

A monument featuring scenes from the Last Judgment, a vision of the Apocalypse, and the rising of the dead is typical for Christian art and architecture. This type of monument is often found in churches, cathedrals, and other Christian religious buildings.

The Last Judgment is a prominent theme in Christian theology and art. It refers to the belief that at the end of time, all souls will be judged by God and either enter heaven or hell. The depiction of this event in art typically includes images of Christ as the judge, the dead rising from their graves, and angels and demons weighing the souls of the departed.

The Apocalypse, or the end of the world, is another prominent theme in Christian art. It refers to the belief that at the end of time, there will be a great battle between good and evil, and God will ultimately triumph over evil.

To know more about judgment here

https://brainly.com/question/29989379

#SPJ4

Would say the United States
acted more neutral BEFORE the "official" start of WW2 in 1939 or AFTER the official start of
WW2? Explain your choice.

Answers

The U.S started out neutral, until they realized their Allies were beginning to lose to axis power, therefore entering the war.

Who invaded the Japanese invasion of Manchuria?

Answers

Answer: The Soviet Union

Explanation:

Answer:

USSR

Explanation:

The USSR broke the non-aggression pact with the Empire of Japan

What invention did Alexander Graham Bell patent in 1876?

Answers

Answer: he invented something so special that changed society

Explanation:

What were medieval europe peasant homes made of and looked like? (also were some made of stones??) How were medieval europe peasant life like??

Answers

Answer:

Made of and looked like: The Medieval House in the Early Europe Medieval Period – Peasants

Peasants' houses from this period may have not survived because they were made out of sticks, straw, and mud. They were one-roomed houses that the family shared with the animals.

Daily Life: Daily life for peasants consisted of working the land. Life was harsh, with a limited diet and little comfort. Women were subordinate to men, in both the peasant and noble classes, and were expected to ensure the smooth running of the household.

I hope this helped you! A brainilist is highly appreciated and helpful! <3

how can i write a long and short essay ?

Answers

Answer:

How can I write short essay?

Be direct and concise; remove repetition; make every word count. Stick to your topic: if there is an idea in your paper that does not serve to answer the question, remove it. Check grammar and punctuation by reading the draft aloud. Ensure you have documented all sources fully and correctly.

-------------------------------------------------------------------------------------------------------------

How can I write long essay?

1. Make sure you included everything on the rubric.

2. Load up on transitional phrases.

3.Spell out your numbers.

4..Ditch the contractions.

5.Use numerous examples.

6.Add quotes.

7.Start getting really descriptive about everything.

8.Try to make your header longer.

9. Have someone proofread.

10. Revisit your introduction paragraph.

11. Make your spacing larger.

12. While you're at it, expand the spacing between the characters.

For a long essay split it up into 4 different parts, intro: what you are talking about, body paragraph 1 and 2: points that support it and outro: a conclusion that summerizes everything.
For a short essay just have one body paragraph and summerize everying. Hope this helps

Statement A: We worked in a place that was noisy and dangerous. We did the same work
over and over again. Many workers, often children, lost fingers, limbs, and even their lives.
Statement B: Government should not interfere in business. To do so would disrupt the
balance of supply and demand.
Statement C: Government has a duty to interfere with business in order to best provide its
people with happy and safe lives.
Statement D: Advances in agricultural techniques and practices resulted in an increased
supply of food and raw materials, causing a movement of the farmers from the
3. countryside to the city.
All of these statements above describe events or viewpoints that relate to the--


A. Berlin Conference
B. Protestant Reformation
C. Industrial Revolution
D. Commercial Revolution

Answers

Basic Response: Workers formed unions in the late 1800s to address their issues. Low pay and dangerous working conditions were their issues. The answer was for the workers to band together and establish unions.

In the first half of the 19th century, which of the following statements best explains how the Industrial Revolution impacted India?

The right response is that Indian handicrafts were destroyed. India was impacted by the Industrial Revolution in England in a variety of ways. English textiles were now posing a serious threat to Indian textiles in the European and American markets. Textiles from India were subject to high taxes in Britain.

When did complicated machines begin to replace manual production processes in the manufacturing of goods?

During the Industrial Revolution, sophisticated machinery began to replace manual manufacturing techniques in the manufacture of commodities. The industrialization era brought about social and economic development.

To know more about Government interfere in business visit:-

https://brainly.com/question/9774644

#SPJ1

actress hedy lamarr invented what technology that aided in wwii?

Answers

Hedy Lamarr's contributions to the war effort as an inventor are explored in The Life & Inventions of Hedy Lamarr. While married to Austrian arms merchant Friedrich "Fritz" Mandl, Lamarr, regarded as "The Most Beautiful Woman in the World."

Amassed expertise in weapons between the 1930s to 1950s. With the help of composer George Antheil, she used this information to help the US Navy during World War II by creating The Secret Communication System, which improved the accuracy of torpedoes. Her discovery, also known as frequency-hopping spread spectrum technology, is used in Wi-Fi, CDMA, GPS, Bluetooth, and a variety of other wireless systems today.

To read more about US Navy click here:

https://brainly.com/question/31109311

#SPJ4

The event described MOST affected the U.S. economy in the late 1800s by-

Answers

A major event that significantly affected the U.S. economy in the late 1800s was the Panic of 1893, which was a severe economic depression that lasted for several years.

The panic was triggered by a series of factors, including overbuilding of railroads, a decline in agricultural prices, and the withdrawal of gold from the U.S. Treasury.

The panic led to the collapse of many businesses, widespread unemployment, and a decline in industrial production. It also had a lasting impact on American politics, leading to increased government intervention in the economy and the rise of populist and progressive movements.

To know more about economic depression, visit:

https://brainly.com/question/12728680

#SPJ1

How did Cortes come to Mexico with 500 soldiers?

Answers

Answer:

Not content on dry land, Cortés was to set sail for Mexico in 1518, this time in command of his own expedition, but Velázquez cancelled the trip. Defiant, Cortés set sail for Mexico anyway with 500 men and 11 ships to seek his fortune.

What was the basis of Adolfo butler’s ideas?

Answers

According to Butler, there is neither an innate nor "real" gender that seeks expression. Instead, according to Butler's argument in Gender Trouble, gender is solely determined by performance.

Who was butler?

American gender theorist and philosopher Judith Butler In the 20th and 21st centuries, political philosophy, feminism, and ethics have all been greatly influenced by Butler's writings. Perhaps his most well-known work is the 1990 novel Gender Trouble. The hypothesis of orientation performativity was presented by women's activist rationalist Judith Steward in her 1990 message Orientation Inconvenience. For Steward, orientation is what you do, not what your identity is. Butler sees gender as rooted in outward signs and actions rather than as something inherent or internal. These performative acts not only create gender but also express an "innate" gender; Gender performance results in the identity it purports to reveal.

To learn more about Gender visit :

https://brainly.com/question/7277651

#SPJ1

in the last quarter of the nineteenth century, american agriculture was characterized by a a decline in the number of farm cooperatives. b a decline in the number of tenant farmers. c a decline in foreclosures on midwestern farms. d an increase in acres under cultivation.

Answers

In the last quarter of the nineteenth century, American agriculture was characterized by an increase in acres under cultivation. Hence, the correct option is d.

An increase in acres under cultivation. The late nineteenth century in the United States was characterized by significant social and economic changes, notably in agriculture.

The second industrial revolution and the development of new machinery changed the way agriculture was carried out on American farms. During the late nineteenth century, American agriculture went through significant changes that transformed the sector.

The last quarter of the nineteenth century in America was marked by an increase in acres under cultivation rather than a decline in farm cooperatives, foreclosures on midwestern farms, or tenant farmers.

The mechanization of farming and expansion of the agricultural frontier in the West had significant effects on American agriculture. In conclusion, during the late nineteenth century in the United States, there was a significant increase in acres under cultivation as a result of the expansion of the agricultural frontier in the West and the mechanization of farming.

To know more about American agriculture:https://brainly.com/question/22683455

#SPJ11

Why did Christianity develop as its own religion?? (One correct answer)

Answers

Answer:

As the Christian movement began to accept non Jewish members it moved further away from the strict rules imposed on Jews.

Explanation:

It became its own religion gradually becomeing seperate.

Why might Isabel find Phillis Wheatley noteworthy?

Answers

Isabel might find Phillis Wheatley noteworthy because she was an enslaved African woman who became the first published African-American female poet. Despite being brought to America as a slave and facing many obstacles, she was able to achieve literary success and gain recognition for her work. Wheatley's story could serve as an inspiration for Isabel, who also faced oppression and struggles as a slave, to see that it is possible to achieve greatness even in difficult circumstances.

Describe a confidant

Answers

Answer:a person with whom one shares a private or confidential matter in the confidence that they will not disclose it to others.

Explanation:

Summarize how railroad strikes led to a controversy over freedom of speech.

Answers

Railroad strikes in the late 19th century resulted in the government suppressing the strike's participants and their advocates, which ignited a controversy over freedom of speech and the government's power to limit it.

What are some important railroad strikes?

Railroad strikes have been a significant part of labor history in the United States. One of the most important was the Great Railroad Strike of 1877, which began as a protest against wage cuts and poor working conditions, but quickly turned into a nationwide strike involving over 100,000 workers and resulted in violent clashes with the police and military.

The Pullman Strike of 1894, which involved workers at the Pullman Palace Car Company, was also significant as it led to the government sending troops to break up the strike and resulted in the imprisonment of union leaders. Another notable strike was the Southern Pacific Strike of 1885, which involved Chinese immigrant workers and led to the creation of the Chinese Exclusion Act of 1882. These strikes had a significant impact on the development of the railroad industry and labor rights in the United States.

To know more about railroad strike, visit:

https://brainly.com/question/24782722

#SPJ9

What was Lyndon B. Johnson’s connection to Texas and helping Jewish people during World War II? i need help ASAP!!!!!!
pls i need help REALLY FASTT!!!!!!!!!!!!

answers.

A. He was from Texas and used his power as a congressman to keep the population of Texas steady during World War II.


B. He tried to persuade the Jewish population leaving Europe to settle in Texas while he was governor of the state.


C. He persuaded many displaced Europeans to move to Texas, which increased the total population of the state.


D. He was a Texas congressman and Navy officer who helped many Jewish people escape the Holocaust and move to Texas.

Answers

The 36th President of the United States of America, Lyndon B. Johnson, who was then a congressman, secretly tried to create a haven in Texas for European Jews fleeing Nazi Germany in 1938. Johnson facilitated the entry of several European Jews into Texas via Mexico, Cuba, and South America.

Why did the US enter World War Two?The Second World War, also known as World War II or just WW2, was a world war that raged from 1939 until 1945. The vast majority of nations in the world, including all of the major powers, took part in the war as members of the Allies and the Axis, two military coalitions that opposed one another. US engagement in both the Pacific and European theatres of World War II was not debated after the Japanese attack on Pearl Harbor on December 7, 1941. With just one opposing vote the day after the attack, Congress declared war on Imperial Japan.The major combatants were the Allies and the Axis nations (Germany, Italy, and Japan) (France, Great Britain, the United States, the Soviet Union, and, to a lesser extent, China).

To learn more about World War II, refer to:

https://brainly.com/question/651584

Other Questions
if a restriction enzyme that recognizes ggcat and cuts between the two guanine residues is mixed with dna that has the sequence ccgattataatcccgcggcatattagggcgg, how many pieces would the resulting product be? which of the following would most directly interfere with sperm production? which of the following would most directly interfere with sperm production? use of synthetic steroids (testosterone) low sperm count interruption of sustentocytes' production of abp ingestion of a substance that mimicked inhibin How did US and Soviet nuclear arsenals compare? Use the equation in the example to find the number ofcups of water you need if you have 12 cups of flour. when carbonyl compounds are reduced with a reagent such as lialh4 or nabh4 and a new stereogenic center is formed, what will the composition of the product mixture be? 7The United States receives more immigrants than any other nation in the world. However, many countries, like Saudi Arabia and Australia, have a greater percentage of their population made up of immigrants. What does this information reveal about these countries? A. They have smaller populations than that of the United States. B. Their life expectancy is less than in the United States. C. They have more lenient immigration policies than those in the United States. D. They encourage immigrants to move there more than the United States does. why is less atp produced by anaerobic respiration than by aerobic respiration? anaerobic respiration does not make use of an electron transport chain. anaerobic respiration uses a final electron acceptor that is less electronegative than o2, which is used as the final electron acceptor in aerobic respiration. anaerobic respiration does not make use of the citric acid cycle. all of these answers are correct. macy does not like a few of the standard operating procedures adapted for the new project. however, she discussed the items with the team and told them that she realized she was in the minority and that she would adapt the new procedures to maintain smooth operations within the team. which conflict-handling mode did macy use? spicy dish, a large distributor of canned beans and salsa, is organized into four business units: (1) north america salsa, (2) north america legume, (3) latin america, and (4) europe and asia. what two types of departmentalization are illustrated in this example? question 8 options: Describe the cities of the Indus River Valley (Use atleast 3 details):3 4. Myron Security, Inc., had total sales for 1 year of $945,860. Their advertising expenses were $57,370. a. Estimate the percent advertising expenses were of total sales. How do u think readers responded to the William Travis letter with this corrective lens in place, what is her new near point? express your answer with the appropriate units. Write an essay of 400-450 words (2-2 pages) on ONE of the following topics. Write downthe NUMBER and TITLE/HEADING of your essay.The goals left behind tony is diagnosed with acid reflux. this is a condition in which stomach secretions which contain hydrochloric acid or hcl, regurgitate (reflux) out of the stomach and into the esophagus. stomach secretions are very acidic with a ph around 2.0. the acids damage the esophagus and it is felt as heartburn. this painful condition can be treated with over-the-counter (otc) antacids. what do you think these antacids are? why are some organizations more efficient and effective at what they do than others? A plan of a school compound is drawn to a scale of 1cm represent 5m. 1 find its length and breadth of the drawing. If the football field is 50m by 30m. 2 if the scale drawing of the hall is 7cm by 32cm rectangle, find its length and breadth The breakdown of lipids and the breakdown o carbohydrates are similar because they both blank energy Find the measure of XY.Y74NX Two of cryus ideas about government explian how these can be an example for leaders of nations today