Zola wrote the area of the rectangle as `2a+3a+4a`.



amir wrote the area as `(2+3+4) a.





explain why they are both correct


please help as quickly as possible


assp

Answers

Answer 1

Both Zola and Amir are correct in writing the area of the rectangle. They have simply used different ways of expressing the same value.

Zola and Amir have both written the area of a rectangle using different algebraic expressions.

Zola wrote the area of the rectangle as `2a + 3a + 4a`, which can be simplified using the distributive property of multiplication:

2a + 3a + 4a = (2 + 3 + 4)a

Therefore, Zola's expression simplifies to `(2 + 3 + 4)a`, which is the same as Amir's expression.

Amir wrote the area of the rectangle as `(2 + 3 + 4) a`, which can also be simplified:

(2 + 3 + 4) a = 9a

Therefore, Amir's expression simplifies to `9a`, which is the same as the sum of the terms in Zola's expression.

Therefore, both Zola and Amir are correct in writing the area of the rectangle. They have simply used different ways of expressing the same value.

To know more about area , refer here :

https://brainly.com/question/30307509#

#SPJ11


Related Questions

Janice bought a new car. the total amount she needs to borrow is $35,000 . she plans on taking out a 5-year loan at an apr of 4%. what is the monthly payment ?

Answers

Janice's monthly payment for her 5-year, 4% APR car loan would be $626.38.

To calculate Janice's monthly payment, we first need to use the formula for calculating loan payments:

Loan Payment = Loan Amount / Discount Factor


The discount factor can be calculated using the following formula:

Discount Factor = [(1 + r)ⁿ] - 1 / [r(1 + r)ⁿ]

Where r is the monthly interest rate (4% divided by 12 months = 0.00333) and n is the total number of payments (5 years x 12 months = 60).


Plugging in the values, we get:

Discount Factor = [(1 + 0.00333)⁶⁰] - 1 / [0.00333(1 + 0.00333)⁶⁰] = 55.8389

Now, we can calculate Janice's monthly payment:

Loan Payment = $35,000 / 55.8389 = $626.38

Know more about loan here:

https://brainly.com/question/11794123

#SPJ11

What is the volume of a rectangular prism with a length of fourteen and one-fifth yards, a width of 7 yards, and a height of 8 yards?

seven hundred ninety-five and one-fifth yd3
seven hundred thirty-nine and one-fifth yd3
four hundred fifty-two and four-fifths yd3
two hundred twenty-six and two-fifths yd3

Answers

The volume of the rectangular prism is 226.2 cubic yards, which is option d.

How to determine the volume?

The volume V of a rectangular prism is given by the formula:

V = lwh

where l is the length, w is the width, and h is the height.

According to given information:

In this case, the length is 14 and one-fifth yards, the width is 7 yards, and the height is 8 yards.

We can substitute these values into the formula and simplify:

V = (14 + 1/5) × 7 × 8

V = (71/5) × 7 × 8

V = 1136/5

V=227.3 ≈ 226.2

Therefore, the volume of the rectangular prism is 226.2 cubic yards.

to know more about volume

brainly.com/question/1578538

#SPJ1

Determine whether or not the given set is (a) open, (b) connected, and (c) simply-connected
A. {(x, y) | 0 < y < 3} B. {(x, y) |1

Answers

For set A, (a) it is not open, (b) it is connected, and (c) it is simply-connected. For set B, (a) it is open, (b) it is not connected, and (c) it is not simply-connected.

(a) For set A, any neighborhood around the point (0,3) will contain points outside the set, so it is not open. For set B, any point can be contained in a small ball that is entirely contained in the set, so it is open.

(b) For set A, any two points can be connected by a path within the set, so it is connected. For set B, the set consists of two disjoint open disks, so it is not connected.

(c) For set A, any loop in the set can be continuously shrunk to a point within the set, so it is simply-connected. For set B, there exists a loop that cannot be continuously shrunk to a point within the set (the loop that surrounds the hole in the middle), so it is not simply-connected.

For more questions like Set click the link below:

https://brainly.com/question/8053622

#SPJ11

True or false: the lateral surface of cone a is exactly 1/2 the lateral surface area of cylinder b

Answers

The lateral surface area of a cone can be less than or greater than half the lateral surface area of a cylinder, depending on the specific dimensions of each shape. The given statement is true.

It depends on the specific dimensions and measurements of cone A and cylinder B. In general, however, it is not true that the lateral surface area of a cone is exactly half the lateral surface area of a cylinder with the same base and height.

The lateral surface area of a cone is given by πrl, where r is the radius of the base and l is the slant height of the cone. The lateral surface area of a cylinder is given by 2πrh, where r is the radius of the base and h is the height of the cylinder.

So, the lateral surface area of a cone can be less than or greater than half the lateral surface area of a cylinder, depending on the specific dimensions of each shape.

To learn more about dimensions visit:

https://brainly.com/question/8286598

#SPJ11

Is 11:15 to 12:15 a hour or 30 minutes

Answers

Answer:

It’s an hour

Answer:

11:15 to 12:15 is 1 hour.

11:15 is 1 hour and 15 minutes after 10:00. 12:15 is 1 hour and 15 minutes after 11:00. Therefore, the time span between 11:15 and 12:15 is 1 hour.

Step-by-step explanation:

Find the absolute maximum value on​ (0, [infinity]​) forf(x)=4x−2xlnx.

Answers

The absolute maximum value on (0, ∞) for f(x) = 4x - 2x ln x is approximately 2e (5.436), which occurs at x = e.

To find the absolute maximum value on (0, ∞) for the function f(x) = 4x - 2x ln x, we need to follow these steps:
1. Determine the critical points of the function by finding its first derivative and setting it equal to zero.
2. Check the critical points for the maximum value.
3. Verify the behavior at the boundary of the interval (0, ∞).

Step 1: Find the first derivative of f(x).
f(x) = 4x - 2x ln x
f'(x) = d/dx (4x) - d/dx (2x ln x)
Using the product and constant rules, we get:
f'(x) = 4 - 2(ln x + 1)

Step 2: Set the first derivative equal to zero to find the critical points.
4 - 2(ln x + 1) = 0
2(ln x + 1) = 4
ln x + 1 = 2
ln x = 1
Solving for x:
x = e^1
x = e (approximately 2.718)

Step 3: Check the behavior at the boundaries.
As x approaches 0 from the right, ln x approaches negative infinity, making the term -2x ln x approach infinity. Since the interval is (0, ∞), we only need to consider the behavior as x approaches ∞. As x goes to infinity, both 4x and -2x ln x will also go to infinity. However, -2x ln x will increase at a slower rate compared to 4x, so f(x) will approach infinity.

Now, we need to check the value of f(x) at the critical point x = e:
f(e) = 4e - 2e ln e
f(e) = 4e - 2e(1)
f(e) = 2e (approximately 5.436)

Thus, the absolute maximum value on (0, ∞) for f(x) = 4x - 2x ln x is approximately 5.436, which occurs at x = e.

To learn more about derivatives visit : https://brainly.com/question/12047216

#SPJ11

Felipe has several 2 liter bottles of lemonade. He wants to pour out 12 glasses for him and his friends each glass holds 500 milliliter of lemonade. How many two liter bottles will he need for all 12 glasses

Answers

Felipe needs a total of 6 liters of lemonade for all 12 glasses. Felipe will need a total of 3 two-liter bottles of lemonade to pour out 12 glasses for him and his friends.

Determining the total amount of lemonade needed:

12 glasses x 500 milliliters per glass = 6,000 milliliters.

Converting the total amount of lemonade needed to liters:

6,000 milliliters / 1,000 milliliters per liter = 6 liters.
Dividing the total amount of lemonade needed by the amount in each bottle:

6 liters / 2 liters per bottle = 3 bottles.

Therefore, Felipe will need 3 two-liter bottles of lemonade to pour out 12 glasses for him and his friends.

To learn more about liter: https://brainly.com/question/13407338

#SPJ11

A. Use the AA Similarity Theorem in writing an if-then statement to describe the illustration
or in completing the figure based on the if-then statement.
R
Н.
If:
P
Then:
AHEY​

Answers

The AA Similarity Theorem states that if two angles of one triangle are congruent to two angles of another triangle, then the triangles are similar. We can complete the figure by drawing a line segment of length 10.5 from point A to point H.

Using this theorem, we can write the following if-then statement to describe the given illustration:

If angle RH is congruent to angle A and angle NH is congruent to angle E, then triangle PHN is similar to triangle AHE.

This means that the corresponding sides of these triangles are proportional to each other. We can use this information to complete the figure by finding the length of side AH.

Since triangle PHN is similar to triangle AHE, we can set up the following proportion:

PH/AH = HN/HE

We know that PH = 6 and HN = 8, and we want to find AH. Let x represent the length of AH.

6/x = 8/14

Cross-multiplying gives us:

6 * 14 = 8 * x

Simplifying:

84 = 8x

Dividing both sides by 8:

x = 10.5

Therefore, we can complete the figure by drawing a line segment of length 10.5 from point A to point H.

To know more about Similarity Theorem, refer to the link below:

https://brainly.com/question/24167205#

#SPJ11

A system of linear inequalities is shown
below. Which of the following points are
solutions of the system?
8x + 5y > 40
-6x +2y >_-18

Answers

The points (0,10) and (-8,4) are solutions of the system of inequalities.

Define system of inequality

A system of inequalities refers to a set of two or more inequalities that are graphed together on the same coordinate plane. Each inequality in the system represents a region in the plane where the solution to that inequality lies.

To determine if a point is a solution of the system of inequalities, we need to check if it satisfies both inequalities. Let's check each point given:

(4,6):

8(4) + 5(6) = 47 > 40 (true)

-6(4) + 2(6) = -14 ≥ 18 (false)

(9,8):

8(9) + 5(8) = 97 > 40 (true)

-6(9) + 2(8) = -40 ≥ 18 (false)

(0,10):

8(0) + 5(10) = 50 > 40 (true)

-6(0) + 2(10) = 20 ≥ 18 (true)

(5,-6):

8(5) + 5(-6) = 34 > 40 (false)

-6(5) + 2(-6) = -30 ≥ 18 (false)

(-1,-8):

8(-1) + 5(-8) = -44 ≤ 40 (false)

-6(-1) + 2(-8) = 10 ≥ 18 (false)

(-8,4):

8(-8) + 5(4) = -24 ≤ 40 (true)

-6(-8) + 2(4) = 52 ≥ 18 (true)

Therefore, the points (0,10) and (-8,4) are solutions of the system of inequalities.

To know more about inequalities, visit:

https://brainly.com/question/30231190

#SPJ1

The angle of elevation of the sun is 35º from the ground. A business building downtown is 50 m tall. How long is the shadow


cast by the building?


Round to one decimal place if necessary and do not include units in your answer.

Answers

To find the length of the shadow cast by a 50 m tall building when the angle of elevation of the sun is 35º from the ground, we can use trigonometry.

Step 1: Identify the known values and the unknown.
- Angle of elevation: 35º
- Building height: 50 m
- Unknown: Shadow length

Step 2: Recognize the trigonometric function to be used.
Since we have the opposite side (building height) and want to find the adjacent side (shadow length), we can use the tangent function. The formula is:

tan(angle) = opposite side/adjacent side

Step 3: Plug in the known values and solve for the unknown.
tan(35º) = 50 m / shadow length

Step 4: Rearrange the equation to isolate the shadow length.
shadow length = 50 m / tan(35º)

Step 5: Calculate the shadow length.
shadow length ≈ 50 m / 0.7002 ≈ 71.4 m

So, the length of the shadow cast by the building is approximately 71.4 m.

To know more about angle of elevation refer here

https://brainly.in/question/19769798#

#SPJ11

A buyer purchases a 2022 Jeep Grand Wagoneer Series III for $109,000 and a 2023 Cadillac Escalade V for $149,000. How much money will he spend a year for car payments?

Answers

The amount of money that he will spend a year for car payment would be = $258,000

How to calculate the total amount of money that will be spent of car payments?

To calculate the amount of money that will be used for car payment the following is carried out.

The cost for purchasing 2022 Jeep Grand Wagoneer Series III = $109,000

The cost for purchasing a 2023 Cadillac Escalade V = $149,000

The total amount spent of car payments = 109000+149000

= $258,000

Therefore, the buyer will spend up to $258,000 a year for car payment when the price for both cars he bought is being summed up.

Learn more about addition here:

https://brainly.com/question/29793687

#SPJ1

A cat darts around a room chasing a ball. The cat first travels along the vector <-1,2> and then chases the ball along the vector <2,-6>. The cat darts after the ball 1.5 times along the vector <4,3>. This is where the cat catches the ball and chews on it. What vector describes the cat’s final position? Show all your work.

Answers

The vector describing the cat's final position is <7,0.5>.

How to explain the vector

The cat first travels along the vector <-1,2> and then chases the ball along the vector <2,-6>. So the cat's position after these two movements is:

<-1,2> + <2,-6> = <1,-4>

The cat's position after this movement is:

1.5 * <4,3> = <6,4.5>

Finally, we add this vector to the cat's previous position to find its final position:

<1,-4> + <6,4.5> = <7,0.5>

Learn more about vector on

https://brainly.com/question/25705666

#SPJ1

In a study of government financial aid for college students, it becomes necessary to estimate the percentage of full-time college students who earn a bachelor's degree in four years or less
find the sample size needed to estimate that percentage. use a 0.01 margin of error and use a confidence level of 95%. assume that nothing is known about the percentage to be estimated

Answers

A sample size of 9604 is needed to estimate the percentage of full-time college students who earn a bachelor's degree in four years or less, with a 95% confidence level and a margin of error of 0.01.

To find the sample size needed to estimate the percentage of full-time college students who earn a bachelor's degree in four years or less, we can use the following formula:

n = [Z^2 * p * (1 - p)] / E^2

where:

Z is the z-score associated with the desired confidence level (95%), which is 1.96
p is the estimated proportion of students who earn a bachelor's degree in four years or less (since we don't have any prior knowledge, we can use 0.5 as a conservative estimate)
E is the margin of error, which is 0.01
Plugging in the values, we get:

n = [(1.96)^2 * 0.5 * (1 - 0.5)] / (0.01)^2
n = 9604

Therefore, a sample size of 9604 is needed to estimate the percentage of full-time college students who earn a bachelor's degree in four years or less, with a 95% confidence level and a margin of error of 0.01.

To learn more about sample size go to:

https://brainly.com/question/30885988?referrer=searchResults

#SPJ11



Joshua is building a model airplane that measures 45 inches. The measurements of the model can vary by as much as 0. 5 inches.



PART 2: Solve the equation to find the minimum and maximum measurements. Round to the nearest tenth if necessary

Answers

The minimum measurement is 44.5 inches and the maximum measurement is 45.5 inches.

Joshua is building a model airplane. Solve the equation to find the minimum and maximum measurements of the airplane.

To find the minimum and maximum measurements of Joshua's model airplane, we need to subtract and add 0.5 inches to the given length of 45 inches, respectively.

Minimum measurement:

45 - 0.5 = 44.5 inches

Maximum measurement:

45 + 0.5 = 45.5 inches

Therefore, the minimum measurement is 44.5 inches and the maximum measurement is 45.5 inches.

Learn more about Joshua's airplane

brainly.com/question/31876228

#SPJ11

Now, take the square root of both sides of the equation (c^2 = n^2) and write the resulting equation. Is there any way for this equation to be true? How?




Only answer if you can properly answer

Answers

Yes, there is a way for this equation to be true in now, take the square root of both sides of the equation (c^2 = n^2) and write the resulting equation

To take the square root of both sides of the equation (c^2 = n^2), you would perform the following steps:

1. Take the square root of both sides:
√(c^2) = √(n^2)

2. Simplify the square roots:
c = n

The resulting equation is c = n.

This equation can be true if both c and n have the same value. This means that c and n could be positive or negative, but their magnitudes must be the same.

For example, if c = 3 and n = 3, then the equation holds true, as both sides are equal.

Similarly, if n = -5, then c could be either 5 or -5, since both values have a magnitude of 5.

To know more about square roots refer here:

https://brainly.com/question/9459418#

#SPJ11

the acme company manufactures widgets. the distribution of widget weights is bell-shaped. the widget weights have a mean of 50 ounces and a standard deviation of 6 ounces. use the standard deviation rule, also known as the empirical rule. suggestion: sketch the distribution in order to answer these questions. a) 68% of the widget weights lie between oz and oz b) what percentage of the widget weights lie between 32 and 56 ounces? % c) what percentage of the widget weights lie below 62

Answers

Answer: this is the answer

Step-by-step explanation:

the acme company manufactures widgets. the distribution of widget weights is bell-shaped. the widget weights have a mean of 50 ounces and a standard deviation of 6 ounces. use the standard deviation rule, also known as the empirical rule. suggestion: sketch the distribution in order to answer these questions. a) 68% of the widget weights lie between oz and oz b) what percentage of the widget weights lie between 32 and 56 ounces? % c) what percentage of the widget weights lie below 62

Write the formula that shows the dependence of the edge length a on the volume V of a cube.

Answers

The formula that shows the dependence of the edge length a on the volume V of a cube is a = ∛V

In other words, to find the edge length of a cube, we take the cube root of its volume. This formula is derived from the formula for the volume of a cube, which is:

V = a³

Here, a is the length of each edge of the cube. Solving this equation for a, we get:

a = ∛V

This formula can be used to find the length of one edge of a cube when its volume is known. Similarly, if the length of one edge is known, the volume can be found using the formula V = a³.

To learn more about volume click on,

https://brainly.com/question/31904479

#SPJ1

consider light falling on a single slit, of width 1.2 μm, that produces its first minimum at an angle of 32.3°. randomized variables θ = 32.3° w = 1.2 μm

Answers

The wavelength of the light is approximately 0.687 μm.

Using the single slit diffraction formula, we have:

sin θ = (mλ) / w

where m is the order of the minimum, λ is the wavelength of the light, and w is the width of the slit.

We can rearrange the formula to solve for the wavelength of the light:

λ = (w sin θ) / m

Plugging in the given values, we get:

λ = (1.2 μm)(sin 32.3°) / 1 = 0.687 μm

Therefore, the wavelength of the light is approximately 0.687 μm.

The wavelength is the distance between two consecutive peaks or troughs in a wave. It is typically represented by the Greek letter lambda (λ) and is measured in meters or other units of length. The wavelength is an important characteristic of any wave, as it determines many of its properties, such as its speed and frequency.

Learn more about wavelength

https://brainly.com/question/31143857

#SPJ4

A positive integer is 40 more than 29 times another. Their product is 10116 . Find the two integers.

Answers

A positive integer is 40 more than 29 times another. Their product is 10116 these two integers are 19 and 571.

In mathematics, an integer is a whole number that can be positive, negative, or zero. Integers can be used to represent quantities such as counting numbers, temperatures, or scores in a game.

How to determine the two integers?

Let's call the two integers x and y, where x is the larger integer and y is the smaller integer.

From the problem, we know that:

x = 29y + 40 (equation 1)

xy = 10116 (equation 2)

We can substitute equation 1 into equation 2 to get:

(29y + 40)y = 10116

Expanding and simplifying:

29[tex]y^{2}[/tex]+ 40y - 10116 = 0

We can use the quadratic formula to solve for y:

y = (-40 ± √([tex]40^{2}[/tex] - 429(-10116))) / (2×29)

y = (-40 ± √308576) / 58

y ≈ 18.95 or y ≈ -12.3

Since y is a positive integer, we can round up to 19.

Now we can use equation 1 to find x:

x = 29y + 40

x = 29(19) + 40

x = 571

Therefore, the two integers are 19 and 571.

To know more about integer

brainly.com/question/15276410

#SPJ1

Jackson makes fruit punch by mixing the ingredients listed below.

6 cups of orange juice
5 pints of fruit punch
8 cups of apple juice

How many quarts of fruit punch does Jackson make?

A.3

B.6

C.24

D.96

Answers

Answer: B

Step-by-step explanation:

First, let's convert the 5 pints of fruit punch to cups:

5 pints = 5 x 2 cups/pint = 10 cups

Now we can add up the cups of each ingredient:

6 cups of orange juice + 10 cups of fruit punch + 8 cups of apple juice = 24 cups

Since there are 4 cups in a quart, we can divide by 4 to get the number of quarts:

24 cups ÷ 4 cups/quart = 6 quarts

Therefore, Jackson makes 6 quarts of fruit punch.

What is the radius of the circle x2+y–
3

4
2=144?

Answers

The radius of the circle x^2 + (y - 3/4)^2 = 144 is 12 units

What is the radius of the circle

From the question, we have the following parameters that can be used in our computation:

x^2 + (y - 3/4)^2 = 144

As a general rule, the equation of a circle is represented as

(x - a)^2 + (y - b)^2 = r^2

Where

Radius = r

Using the above as a guide, we have the following:

r^2 = 144

SO, we have

r = 12

Hence , the calculated value of the radius is 12 units

Read more about circle equation at

https://brainly.com/question/24810873

#SPJ1

Dai orders milk with her meal. The server asks her if she wants regular or chocolate. Dai can choose from skim, 2%, or whole, and from small, medium, or large. If all of the choices are equally likely to be ordered, what is the probability that Dai orders a regular, medium milk? Write a whole number or fractions

Answers

The probability of Dai ordering a regular, medium milk is 1/18.

What is the probability of an event? Calculate the total number of possible milk orders.

There are 2 types of milk (regular and chocolate), and 3 sizes (small, medium, and large), and 3 levels of fat content (skim, 2%, and whole). So the total number of possible milk orders is:

2 (types of milk) x 3 (sizes) x 3 (fat content) = 18

Calculate the number of ways Dai can order a regular, medium milk.

Dai needs to choose regular milk and medium size, so there is only one way she can order this combination.

Calculate the probability of Dai ordering a regular, medium milk.

The probability of Dai ordering a regular, medium milk is the number of ways she can order a regular, medium milk divided by the total number of possible milk orders:

1 (number of ways to order a regular, medium milk) / 18 (total number of possible milk orders) = 1/18

So the probability that Dai orders a regular, medium milk is 1/18 or approximately 0.056 (rounded to three decimal places).

Learn more about Probability.

brainly.com/question/30034780

#SPJ11

Camila empieza a jugar un video juego que tiene 840 niveles. La primera semana, supera 16
parte de los niveles; la segunda semana, 14
de lo que le hace falta y la tercera, 45
de los niveles que le hacían falta por superar.

Si en la cuarta semana Camila pretende terminar el juego, ¿cuántos niveles debe superar?

A.
95

B.
105

C.
182

D.
420

Answers

The amount of levels left at the end is 105.

How many levels Camila needs to complete?

There is a total of 840 levels in the game.

On the first day she completes 1/6 of the total, so she completes:

840/6 = 140

The remaining is 840 - 140 = 700

Then she completes 1/4 of that, which is:

(1/4)*700 = 175

So now she has left 700 - 175 = 525

Then she completes 4/5, so she does:

(4/5)*525 = 420

The amount left is: 525 - 420 = 105

The correct option is B.

Learn more about fractions at:

https://brainly.com/question/11562149

#SPJ1

Cuánto interés ganará lesli si presta l 5000 a pagar en 3años? al:5%simple anual. 10%simple anual. 5%compuesto anual

Answers

Lesli ganará $750 de interés si presta $5000 a pagar en 3 años al 5% de interés simple anual.

How much interest will Leslie earn if she lends $5000 to be paid back in 3 years at a simple annual interest rate of 5%, 10%, and a compound annual interest rate of 5%?

Para calcular el interés que ganará Leslie en diferentes escenarios, consideraremos los siguientes casos:

A) Tasa simple anual del 5%:

El interés simple se calcula multiplicando el capital prestado por la tasa de interés y el tiempo en años.

Interés = Capital x Tasa x Tiempo

Interés = 5000 x 0.05 x 3 = $750

B) Tasa simple anual del 10%:

De manera similar al caso anterior, el interés se calcula como:

Interés = 5000 x 0.10 x 3 = $1500

C) Tasa compuesta anual del 5%:

En el caso de la tasa de interés compuesta, los intereses se acumulan en cada período. La fórmula para calcular el monto total es:

Monto = Capital x (1 + Tasa)^Tiempo

Monto = 5000 x (1 + 0.05)^3 = $5788.75

Learn more about diferentes

brainly.com/question/18769068

#SPJ11

help me please i legit need help with pythagorean theorm

Answers

Answer:

1. [tex]9^{2} + 12^2 = 15^2\\81+144=225[/tex]

The graph shows the temperature (with degrees Celsius measured on the y-axis) at different times during one winter day. Negative values of x represent times earlier than noon and positive values of x represent times later than noon. How many degrees Celsius did the temperature change from 9 a.m. to noon?

Answers

The amount the temperature during the day changed between 9 a.m. and 12 noon, obtained using arithmetic operations is 8 °C increase in the temperature

What are arithmetic operations?

Arithmetic operations are mathematical operations such as addition subtraction, division and multiplication.

The possible points on the scatter plot graph, obtained from the graph of a similar question posted online are; (-3, 2), (0, 10), and (4, 4)

The coordinate point on the graph corresponding to 9 a.m. is (-3, 2)

Therefore, the temperature at 9 a.m. is 2°C

The coordinate point on the graph corresponding to 12 noon is (0, 10)

Therefore, the temperature at 12 noon. is 10°C

The change in temperature between the temperature at 9 a.m. and the temperature at 12 noon = 10°C - 2°C = 8 °C (Increase in temperature)

Please find attached the possible scatter plot in the question

Learn more on scatter plot here: https://brainly.com/question/29980562

#SPJ1

Find the area inside the square and outside the circle use 3.14 for pi. please help

Answers

The area inside the square and outside the circle is 0.86 square units.

To find the area inside the square and outside the circle, we need to first find the area of the square and the area of the circle.

Let's assume that the square has sides of length 2 units, which means its area is:

Area of square = side^2 = 2^2 = 4 square units

Now, let's assume that the circle has a radius of 1 unit, which means its area is:

Area of circle = pi * radius^2 = 3.14 * 1^2 = 3.14 square units

To find the area inside the square and outside the circle, we need to subtract the area of the circle from the area of the square:

Area inside square and outside circle = Area of square - Area of circle

                                     = 4 - 3.14

                                     = 0.86 square units

Therefore, the area inside the square and outside the circle is 0.86 square units.

To know more about area, visit:

https://brainly.com/question/27683633#

#SPJ11

PLEASE HELP!!



A sprinkler sprays water in a circle. The distance from the sprinkler to the outer edge of the circle is 2. 5 m.


What is the approximate area that is watered by the sprinkler? (Use 3. 14 as an estimate for It. )

Answers

The approximate area that is watered by the sprinkler, we need to use the formula for the area of a circle, which is A = πr^2, where A is the area, π is a constant equal to approximately 3.14, and r is the radius of the circle.

In this case, we are given that the distance from the sprinkler to the outer edge of the circle is 2.5 m, which is the radius of the circle. Therefore, we can substitute this value into the formula and get:

A = [tex]3.14 x 2.5^2[/tex]

A =[tex]19.625 m^2[/tex]

So, the approximate area that is watered by the sprinkler is 19.625 square meters. This means that any plants, grass or other vegetation within this area will receive water from the sprinkler.

It is important to note that this is only an approximation since the shape of the watered area may not be a perfect circle and the sprinkler may not spray water evenly in all directions.

Additionally, the amount of water sprayed by the sprinkler and the time it takes to water the area will also affect the actual amount of water received by the plants.

To know more about area of a circle refer here

https://brainly.com/question/28642423#

#SPJ11

In a game show, players play multiple rounds to score points. Each round has 5 times
as many points available as the previous round.

Answers

An equation shows the number of points available, p, in round n of the game show is p=20·5ⁿ. Therefore, option D is the correct answer.

The given geometric sequence is 20, 100, 500, 2500,...

Here, a=20

Common ratio (r) = 100/20 = 5

The formula to find nth term of the geometric sequence is [tex]a_n=ar^n[/tex]. Where, a = first term of the sequence, r= common ratio and n = number of terms.

Here, aₙ=20·5ⁿ

Therefore, option D is the correct answer.

To learn more about the geometric sequence visit:

https://brainly.com/question/11266123.

#SPJ1

A farmer uses a lot of fertilizer to grow his crops. The farmer’s manager thinks fertilizer products from distributor A contain more of the nitrogen that his plants need than distributor B’s fertilizer does. He takes two independent samples of four batches of fertilizer from each distributor and measures the amount of nitrogen in each batch. Fertilizer from distributor A contained 21 pounds per batch and fertilizer from distributor B contained 16 pounds per batch. Suppose the population standard deviation for distributor

Answers

Calculated t-value of 6.93 is greater than the critical value, we reject the null hypothesis and conclude that there is strong evidence that the mean amount of nitrogen in distributor A's fertilizer is significantly greater than the mean amount of nitrogen in distributor B's fertilizer.

Since we do not have the population standard deviation, we will need to use the t-distribution for our hypothesis test. We are interested in testing whether the mean amount of nitrogen in distributor A's fertilizer is significantly greater than the mean amount of nitrogen in distributor B's fertilizer.

Let μA be the true mean amount of nitrogen in distributor A's fertilizer and μB be the true mean amount of nitrogen in distributor B's fertilizer. Our null hypothesis is:

H0: μA - μB ≤ 0

The alternative hypothesis is:

Ha: μA - μB > 0

We will use a one-tailed test with a significance level of 0.05. Since we have two independent samples with sample sizes of 4 each, we will use a pooled t-test with the following formula:

t = ([tex]\bar{X1}[/tex] - [tex]\bar{X2}[/tex] - D) / (sP * √(2/n))

where [tex]\bar{X1}[/tex] and [tex]\bar{X2}[/tex] are the sample means, D is the hypothesized difference between the population means, sP is the pooled standard deviation, and n is the sample size.

To calculate the pooled standard deviation, we can use the following formula:

sP = √(((n1-1)*s1² + (n2-1)*s2²) / (n1+n2-2))

where n1 and n2 are the sample sizes, and s1 and s2 are the sample standard deviations.

Plugging in the given values, we get:

[tex]\bar{X1}[/tex] = 21, [tex]\bar{X2}[/tex] = 16

s1 = s2 = 1.5 (since we are assuming the population standard deviation is the same for both distributors)

n1 = n2 = 4

D = 0 (since the null hypothesis is that there is no difference in the means)

sP = √(((4-1)*1.5² + (4-1)*1.5²) / (4+4-2)) = 1.5

Using these values, we get:

t = (21 - 16 - 0) / (1.5 * √(2/4)) = 6.93

Looking at a t-distribution table with 6 degrees of freedom (4+4-2), we find that the critical value for a one-tailed test at a significance level of 0.05 is approximately 1.943. Since our calculated t-value of 6.93 is greater than the critical value, we reject the null hypothesis and conclude that there is strong evidence that the mean amount of nitrogen in distributor A's fertilizer is significantly greater than the mean amount of nitrogen in distributor B's fertilizer.

To know more about null hypothesis, refer to the link below:

https://brainly.com/question/28920252#

#SPJ11

Complete Question:

A farmer uses a lot of fertilizer to grow his crops. The farmer's manager thinks fertilizer products from distributor A contain more of the nitrogen that his plants need than distributor B's fertilizer does. He takes two independent samples of four batches of fertilizer from each distributor and measures the amount of nitrogen in each batch. Fertilizer from distributor A contained 23 pounds per batch and fertilizer from distributor B contained 18 pounds per batch. Suppose the population standard deviations for distributor A and distributor B are four pounds per batch and five pounds per batch, respectively. Assume the distribution of nitrogen in fertilizer is normally distributed. Let ?1 and ?1 represent the average amount of nitrogen per batch for fertilizer's A and B, respectively. Calculate the value of the test statistic

Other Questions
A spotlight is mounted on the eaves of a house 20 feet above the ground. A flower bed runs between the house and the sidewalk, so the closest the ladder can be placed to the house is 15 feet. How long a ladder is needed so that an electrician can reach the place where the light is mounted If f(x) is defined as follows, find (a) f(-3), (b) f(0), and (c) f(4).xif x < 0if x = 03x + 3 ifx>0f(x) = 0(a) f(-3)= (Simplify your answer.)THE The operating system is not presently configured to run this application. A pressure switch is used in a washing machine to control the flow of water. The water pushes on a flexible container and compresses some trapped air. When the pressure of this trapped air reacher 104 kPa, the pressure switch turns the water off. The pressure of the trapped air is given by this relationship: pressure of the trapped air - atmospheric pressure + pressure difference caused by the water. Calculate the height of water in the machine when the pressurre of the trapped air reaches to 104 kPa and the switch operates. (atmospheric pressure = 100 kPa, density of water = 1000 kg/m^3) How to find out if a solid, more specifically powdered cement, is acid or alkali? Between 1940 and 1955, the average income for a u.s. family tripled. this was likely the result of- reduced unemployment - the expansion of corporations & creation of more white-collar jobs- all of these choices are correct- more women entering the workplace A car repair shop specialises in exhaust pipe replacement. Every year it costs $34,800 to rent the shop and maintain their equipment and $50,000 to pay their employees. For every exhaust pipe replaced the repair shop charges the customer the price of the parts required plus $248 as a service charge. How many exhaust pipe replacements does the repair shop need to complete in order to break even? 4. Calculate and properly express the 2017 accounts receivable turnover ratio for OReilly Auto Parts. ASSUME ALL SALES REPRESENT CREDIT SALES. (6 pts)8,977,726/216,251+197,274/2 = 8,977,726/206762.5 = 43.4 times Answer: 43.4 times5. Calculate and properly express the 2017 (fiscal year ended August 26, 2017) accounts receivable turnover ratio for AutoZone. ASSUME ALL SALES REPRESENT CREDIT SALES. (6 pts)10,888,676/280,733+287,680/2 = 10,888,676/284206.5 = 38.3 timesAnswer: 38.3 times6. Calculate and properly express the average collection period for each company. (6 pts)OReilly Auto Parts: 365/43.4 = 8.4 daysAutoZone: 365/38.3 = 9.5 daysAnswer: OReilly Auto Parts: 8.4 daysAutoZone: 9.5 days7. Which company has a better receivable turnover ratio and why? Explain in three complete sentences. (4 pts)8. Calculate and properly express the 2017 inventory turnover ratio of OReilly Auto Parts. (6 pts)4,257,043/3,009,800+2778,976/2 = 4,257,043/2,894,388 = 1.5 timesAnswer: 1.5 times9. Calculate and properly express the 2017 (fiscal year ended August 26, 2017) inventory turnover ratio of AutoZone. (6 pts)5,149,056/3,882,086+3,631,916/2 = 1.4 timesAnswer: 1.4 times10. Calculate the average days to sell inventory for each company. (6 pts)OReilly Auto Parts: 365/1.5 = 243.3 daysAutoZone: 365/1.4 = 260.7 days Answer: OReilly Auto Parts: 243.3 daysAutoZone: 260.7 days11. Which company has a better inventory turnover ratio? (2 pts) Why, what does this ratio represent? Explain in a short paragraph. (4 pts)I need a answer for n 7 and 11 Which of the following examples of figurative language from the poem best supports the idea that Susan B. Anthony was ahead of her time?A.On ground hard held to the last, gaining her goal for womenB. Her life is a luminous banner bome ever ahead of her eraC. Her spirit like southern starlight at once is afar and around usD. In the mine, the mill and the mart where is bartered the bread of your children At what condition do magnesium chloride and silver nitrate react? this is due now !!!!!!!! 98. How many start codons are there?99. How many stop codons are there?100.101. The process of translation takes place in the102. Replication and Transcription both take place in theSecond baseFirst baseUGUUUUUCUUAUUGCUUCUCCUACUGsignals the end of the process ofGUUGUCGUAGUGlek ne(LewAUUAUCAUAAUG theone (Met)(ke)ne(Val)UCUUCCUCAUCGCCUCCCCCACCGACUACC theACA(MhviACGGCUGCCGCAGCGAlaUAUUACUAAUAGAAUAACCAU histidineCACCAACAG6AAAAAGGAUGACtyfouneGAAGAGSTOPgutamineof the cell.(Avilboneof the cell.UGUUGCUGAUGG tryptophan (1)CGUCGCCGACGGAGUAGCAGAAGGpart and GGUGGOGGAGGGKVMargune(Arg)(Gly)DYSCU3Third baseGC A museum sells stone souvenirs shaped like a cone with a diameter of 4.2 centimeters and a height of 9.5 centimeters. What is the volume of each souvenir? Round to the nearest tenthPLEASE HURRY Determine the measure of arc cad thanks grade 9-10-11 it is either 240 or 260 Basic body color for wolves is influenced by several genes, one of which has several different alleles. Two of these alleles-white coat and black coat-display incomplete dominance. A wolf is heterozygous for these two alleles displays a gray coat. Is it possible to produce a line of pure-breeding gray wolves? Why or why not?Incomplete dominance: blended traits IreadyHow were adventure playgroundsof the 1960s different fromplaygrounds of the 1920s? If your starting salary is $50,000 and you receive a 4% increase at the end ofevery year, what is the total amount, in dollars, you will earn over the first 16years that you work?Round your answer to the nearest whole dollar, and express your answerwithout using commas.Answer hereSUBMIT 13. If the supply of gasoline rises, name a substitute that will increase in demand? 14. How do you think each of the following affected the world price of oil? List if it will effect supply or demand, and the price change if any. Use basic supply and demand analysis. a. Tax credits were offered for expenditures on home insulation. b. The Alaskan oil pipeline was completed. c. Oil was discovered in Mexico and the North Sea. d. Sport Utility Vehicles and minivans became popular. e. Natural oil reserves became depleted Which is the BEST way to distribute aerobic activity throughout the week? one long session in a single day two equally long sessions separated by several days several equally long sessions spread over the week. several equally long sessions in one or two days Explain the key differences (not just the definitions) between the four functional areas of theorganization. Also, explain why we need all four areas for a business to prosper.