The important job of all tissues, organs and organ systems in multicellular organisms is to maintain homeostasis.
Correct option is B.
Homeostasis is the maintenance of a relatively constant internal environment in living organisms that is necessary for survival. Homeostasis can be described as a condition of equilibrium, or balance, within an organism's internal environment.
Maintaining homeostasis is an important job of all tissues, organs and organ systems in multicellular organisms. Homeostasis is maintained by the coordination of many different systems and processes, including the nervous, endocrine, and immune systems, as well as the cardiovascular and respiratory systems.
It is important to maintain homeostasis because even minor changes in the internal environment can lead to significant problems or even death.
Homeostasis is a fundamental concept in biology and is essential for the proper functioning of all living organisms.
For more question on homeostasis click on
https://brainly.com/question/28462465
#SPJ11
what was the Mesozoic terrestrial reptile called that walked in an upright stance.
The Mesozoic terrestrial reptile that walked in an upright stance is called the dinosaur.
Dinosaurs are a group of reptiles that lived during the Mesozoic era, which is also known as the Age of Reptiles. They were the dominant terrestrial vertebrates for over 135 million years, until their extinction at the end of the Cretaceous period.
They were able to walk in an upright stance due to their skeletal structure and musculature that allowed them to support their massive bodies on two legs instead of four. Some examples of dinosaurs that walked on two legs include the T-Rex, Velociraptor, and Stegosaurus.
To know more about dinosaur refer here:
https://brainly.com/question/7104775#
#SPJ11
the period from fertilization through week eight is called the embryonic period. the period from fertilization through week eight is called the embryonic period. true false
The statement "the period from fertilization through week eight is called the embryonic period" is true.
The period that begins at fertilization and ends in the 8th week of gestation is referred to as the embryonic period.
This is the stage when embryonic cells begin to differentiate, and the developing embryo becomes more complex.
This is the period when the zygote undergoes mitotic divisions and eventually forms a ball of cells called the blastocyst.
The blastocyst is a hollow, fluid-filled ball of cells that forms after about five days of development.
The embryonic period is considered to be the most important period in human development because this is when all of the major organs, tissues, and systems are formed, including the neural tube, which eventually becomes the brain and spinal cord.
This is also when the heart, limbs, eyes, ears, and other essential structures begin to form. Basically, the embryonic period is a crucial stage of development that lasts from fertilization to the eighth week of pregnancy.
This is when the zygote grows into a more complex organism with all of its critical structures and systems in place.
To know more about fertilization, refer here:
https://brainly.com/question/891433#
#SPJ11
b. Describe the fragile ecosystems in your environment that need protecting.
such as wetlands, desert areas, riparian areas, forested and deforested areas,
etc. How are these areas protected? Provide data from your research to explain
your answers. (3 points)
Answer:
Explanation:
Fragile Ecosystem is a system which is very tender and under threat of loosing it's original condition and has reached its level of threshold beyond which it would not be able to sustain any damage.
Factors which make an ecosystem fragile are the following :-
1) Anthropogenic - Man is a major agent of change in our ecosystem and is doing great damage to the existing avenues.Distructing ventures of humans can be further divided into :-
a) Economic- Ecosystem equilibrium is disturbed for meagre financial gains.Minerals exploration and Tourism are two major factors for disturbing the
ecosystem.
Ex - Increasing number of hotels coming up in sensitive zones as WESTERN GHATS.
b) Political - Despite continuous reports ad committes on the worsening condition of ecosystems, the recommendations are not executed owing lack of political will and lethargic attitude of
administration
c) Psychological - Inhabitants as well as policy makers don't consider the protection of ecosystem at war footing because psychologically they dont consider it as a real threat and hold no responsibility for the outcomes
Regions in India having fragile ecosystem are:-
1)WWestern Ghats which are also under biodiversity rich list of UNESCO
2) Himalyan Mountains ranging from Kashmir to North East India.
3) Sunderban which is the largest delta in the world is also a fragile zone.
India has a well researched strategy to support the fragile ecosystems but effective implementation along with general awareness among the masses about its crucial role in the environment needs to be emphasised.
an increase in the permeability of the cells of the collecting tubule to water is due to a(n) . an increase in the permeability of the cells of the collecting tubule to water is due to a(n) . decrease in the concentration of the blood plasma decrease in the production of adh increase in the production of aldosterone increase in the production of adh
An increase in the permeability of the cells of the collecting tubule to water is due to an increase in the production of antidiuretic hormone (ADH).
What is ADH?
The antidiuretic hormone (ADH), also known as vasopressin, is produced by the hypothalamus and released by the pituitary gland in response to increased solute concentration in the blood, low blood volume, or low blood pressure.
ADH stimulates the kidneys to conserve water by increasing the permeability of the collecting ducts to water, allowing more water to be reabsorbed into the bloodstream and less to be excreted in the urine.
This increased water permeability of the collecting tubule cells is referred to as facultative water reabsorption, and it is critical for maintaining water balance in the body.
Learn more about antidiuretic hormone (ADH) here:
brainly.com/question/29544229
#SPJ11
explain why it is important to have a variety of organisms in a community of interacting species give an example
It is important to have a variety of organisms in a community of interacting species because each species plays a unique role in maintaining the balance and stability of the ecosystem.
A diverse community is more resilient to changes or disturbances, as it can better cope with changes in environmental conditions and species loss. For example, if a predator species were to go extinct, it could lead to a proliferation of its prey, which could in turn have cascading effects on other species in the community. Similarly, the loss of a plant species could have negative impacts on pollinators and herbivores that rely on that plant for food or habitat. Therefore, a variety of species ensures that different niches are filled and the ecosystem is more stable and sustainable.
To know more about ecosystem click here:
brainly.com/question/12628269
#SPJ4
What is the smallest subunit of muscle contraction, which is measured from z-line to z-line?
The smallest subunit of muscle contraction, which is measured from z-line to z-line is called a sarcomere. The movement that occurs in muscle tissue as a result of a stimulus is known as muscle contraction.
Muscle fibers use ATP to produce tension and generate movement through the contractile process. It is an important physiological mechanism that aids in the maintenance of posture, movement, and the performance of vital life processes.
Sarcomere is the structural and functional unit of a myofibril in striated muscle, with Z discs (Z lines) defining its boundaries. It is the region of the myofibril between two adjacent Z-lines that undergoes shortening when muscle fibers contract.
The thin filaments (composed of actin, tropomyosin, and troponin proteins) are attached to the Z-discs, while the thick filaments (composed of myosin proteins) are anchored in the center of each sarcomere, where they overlap with the thin filaments. When muscle fibers contract, the myosin heads pull the thin filaments closer to the center of the sarcomere, resulting in the shortening of the sarcomere and overall muscle contraction.
know more about sarcomere here
https://brainly.com/question/14005497#
#SPJ11
which process may affect the evolution of color patterns in poeciliids?
The evolution of color patterns in poeciliids can be influenced by a variety of processes, including:
Sexual selectionNatural selectionGenetic driftWhat are poeciliids?Poeciliids are a family of freshwater fish that are commonly known as livebearers because they give birth to live young instead of laying eggs. Poeciliids are found primarily in the Americas, ranging from the southern United States down to Argentina, and they are especially diverse in Central America and the Caribbean.
Poeciliids are small fish, typically reaching only a few inches in length, and they come in a wide range of colors and patterns. Some of the most well-known poeciliids include guppies, mollies, swordtails, and platies, which are popular aquarium fish due to their colorful appearance and ease of care.
Learn about Natural selection here https://brainly.com/question/15577096
#SPJ1
in which country was the goldfish originally domesticated
Even before the structure of DNA was known, studies indicated that the genetic material must have the following properties:
•be able to store information
•be consistently replicated between generations
•be able to allow for changes, and thus evolution, to occur
Explain how the structure of DNA gives it these three properties. Write one or two sentences per property.
The double helix structure of DNA allows it to store information in the sequence of its nucleotides. DNA replication is possible because of the complementary base pairing, which allows each strand of DNA to serve as a template for the formation of a new complementary strand. The occurrence of mutations during replication and other processes, as well as the ability of DNA to be repaired, allow for genetic variation and evolution to occur.
How does the complementary base pairing of DNA contribute to its ability to store information?The complementary base pairing of DNA allows for the specific sequence of nucleotides to act as a code that stores genetic information. The order of the bases determines the genetic instructions for the organism.
How does the process of DNA repair allow for evolution to occur?The process of DNA repair allows for mistakes or mutations in DNA to be corrected, preventing genetic abnormalities from being passed on to the next generation. However, mutations that are not repaired can lead to genetic variation and may provide an advantage or disadvantage to the organism in certain environments, ultimately allowing for evolution to occur.
Learn more about DNA here:
https://brainly.com/question/264225
#SPJ1
explain how the skeletal system effects other body systems.
The bones of the skeletal system serve to protect the body's organs, support the weight of the body, and give the body shape. The muscles of the muscular system attach to these bones, pulling on them to allow for movement of the body.
Internal support for the human body is provided by the skeleton. Around 270 bones make up its structure at birth; by adulthood, after certain bones have fused together, this number drops to approximately 206 bones. The amount of bone mass in the skeleton accounts for around 14% of total body weight (roughly 10–11 kg for the average person) and achieves its maximum mass between the ages of 25 and 30.
The axial and appendicular skeletons of the human body are distinct from one another. The axial skeleton is made up of the spinal column, rib cage, skull, and other supporting bones. The shoulder girdle, pelvic girdle, and bones in the upper and lower limbs make up the appendicular skeleton, which is connected to the axial skeleton.
To know more about skeletal system click here:
https://brainly.com/question/1283837
#SPJ4
Maintaining hydration during endurance events is most likely to be challenging due to _____.a. lack of access to hydration liquids b. a decrease in kidney function during exercise c. an increase in blood pressure during exercise d. sweat rates that exceed gastric emptying and absorption rates
Maintaining hydration during endurance events is most likely to be challenging due to sweat rates that exceed gastric emptying and absorption rates. The correct answer is Option D.
What is endurance?Endurance is the ability to maintain or repeat an activity for a prolonged period of time. Physical endurance refers to a person's ability to persist in physical activities for an extended period of time or to perform many repetitions of a movement. The following are examples of endurance activities:
Running is a form of aerobic endurance. Running, biking, swimming, and rowing are examples of activities that use endurance. The body's energy needs are met by aerobic endurance activities. The body's ability to consume and use oxygen (respiration) is improved by such activities.
Hydration during endurance eventsMaintaining hydration during endurance events is critical for maintaining health and performance. Dehydration may lead to cramps, heat exhaustion, and heat stroke, as well as impairing endurance performance. Sweat rates that surpass gastric emptying and absorption rates are the most common reason of decreased hydration. When the body's core temperature rises, it begins to perspire to maintain its temperature.
Perspiration is the body's mechanism of cooling itself. As a result, sweat rates increase in response to higher temperatures. Sweat has to be replaced to keep hydrated. Sweat, on the other hand, may not be replaced as quickly as it is released. Sweat rates surpass gastric emptying and absorption rates, leading to dehydration. As a result, it is critical to drink enough fluids during endurance events.
Learn more about Endurance here: https://brainly.com/question/28712439
#SPJ11
which event occurs when myocardial oxygen demand exceeds oxygen supply?
The correct option is D, Lactic acid is formed and irritates myocardial nerve fibers occurs when myocardial oxygen demand exceeds oxygen supply.
Myocardium refers to the muscular tissue of the heart that is responsible for contracting and pumping blood throughout the body. It is one of the three main layers of the heart wall, along with the endocardium and epicardium. The myocardium is made up of specialized cardiac muscle cells called cardiomyocytes that are interconnected through intercalated discs.
These cells contract rhythmically and synchronously in response to electrical impulses generated by the sinoatrial (SA) node, which is located in the right atrium of the heart. The myocardium receives its blood supply from the coronary arteries, which branch off from the aorta and encircle the heart. If these arteries become blocked or narrowed, it can lead to a heart attack or myocardial infarction, which can cause irreversible damage to the heart muscle.
To learn more about Myocardial visit here:
brainly.com/question/30510298
#SPJ4
Complete Question: -
Which event occurs when myocardial oxygen demand exceeds oxygen supply?
a.Myocardial cells increase metabolism.
b.Unstable angina progresses to an ST-segment myocardial infarction (STEMI).
c.The body compensates by decreasing the heart rate.
d.Lactic acid is formed and irritates myocardial nerve fibers.
if a restriction enzyme that recognizes ggcat and cuts between the two guanine residues is mixed with dna that has the sequence ccgattataatcccgcggcatattagggcgg, how many pieces would the resulting product be?
The restriction enzyme that recognizes ggcat and cuts between the two guanine residues is HindIII. When HindIII is mixed with the DNA sequence ccgattataatcccgcggcatattagggcgg, the resulting product would be two pieces.
What are restriction enzymes?Restriction enzymes are proteins that are used in molecular biology to break down DNA molecules by recognizing specific nucleotide sequences and cleaving them. Restriction enzymes are used in genetic engineering to create recombinant DNA molecules.
How do restriction enzymes work?Restriction enzymes recognize and bind to specific nucleotide sequences in DNA known as recognition sites. The recognition site is usually a specific palindromic sequence of four to six base pairs. Palindromic means that the nucleotide sequence is identical when read in the forward or backward direction.
Restriction enzymes cut DNA by creating a break in both strands of the DNA helix at specific points relative to the recognition site. This creates "sticky ends" that can be joined to other DNA molecules that have complementary overhanging ends.
The recognition sequence of HindIII is 5' G-A-N-T-C 3' and 3' C-T-N-A-G 5'. When HindIII cuts the DNA sequence ccgattataatcccgcggcatattagggcgg, it will cleave between the two guanine residues (G) in the recognition sequence ggcat, resulting in two fragments:ccgattataatcccgcggcat | attagggcgg (sticky ends are indicated by vertical bars)
To know more about restriction enzyme refer to-
brainly.com/question/29882269#
#SPJ11
what type of mutation is huntington disease
HD is caused by a mutation in the gene for a protein called huntingtin. The defect causes the building blocks of DNA called cytosine, adenine, and guanine (CAG) to repeat many more times than they normally do. Most people have fewer than 27 CAG repeats in their HD gene, so they are not at risk for the disease
a condition of reduced muscle tension, cortical activity, heart rate, breathing rate, and blood pressure is termed:
The condition of reduced muscle tension, cortical activity, heart rate, breathing rate, and blood pressure is termed as "Relaxation Response."
The relaxation response is the opposite of the body's stress response, and it's a state of deep rest that enhances the body's ability to heal and recover from stress-related symptoms.
According to Herbert Benson, M.D., who founded Harvard's Mind/Body Medical Institute, "we use the relaxation response to change the fundamental state of our physical and mental functioning, causing a reduction in anxiety, insomnia, and hypertension."
The relaxation response is characterized by the following signs: Reduction in blood pressure, Slow breathing rate, Improved metabolism, Decreased heart rate, Reduced muscle tension, Less perspiration, Better sleep patterns, Enhanced immune function, Lower blood lactate levels and Improved mood.
To know more about Relaxation Response, refer here:
https://brainly.com/question/13834897#
#SPJ11
true or false? the healing aspect of the laughter response is thought to promote the release of various chemical messengers, which in turn strengthen the integrity of the immune system.
The given statement is "The healing aspect of the laughter response is thought to promote the release of various chemical messengers, which in turn strengthens the integrity of the immune system." is True
Laughter has been shown to have various health benefits, including reducing stress and improving the function of the immune system.
What is the immune system?The immune system is a complex network of cells, tissues, and organs that work together to defend the body against infections, diseases, and other foreign invaders. The immune system is divided into two main parts: the innate immune system and the adaptive immune system.
The innate immune system is the first line of defense against infections and diseases. It includes physical barriers, such as the skin and mucous membranes, as well as specialized cells and proteins that recognize and eliminate foreign invaders.
The adaptive immune system is a more specialized system that is activated when the innate immune system is not enough to control an infection or disease. It includes immune cells called B cells and T cells that recognize and destroy specific pathogens, as well as memory cells that remember and respond to previous infections or vaccinations.
To know more about Immune system refer here:
https://brainly.com/question/19843453#
#SPJ11
Artificial selection can be used to produce new strains of animals that have favorable traits. Despite its usefulness, it would be difficult to use artificial selection to produce cows that produce their own antibiotics to protect themselves from disease. Why can’t artificial selection be used for this purpose?
A. Antibiotics are used only in humans and not in cows.
B. The pathway for antibiotic production requires too many enzymes for selection.
C. Cows do not possess the specialized organs used by other creatures to produce antibiotics.
D. A gene for producing antibiotics does not appear in the cow population and therefore cannot be selected for.
Answer:
The correct answer is D.
Artificial selection is the process of selecting and breeding individuals with desirable traits to create a population with those traits. However, for this to work, the desirable traits must already exist in the population, and be heritable. In other words, the traits must be encoded in the DNA of the individuals.
In the case of cows producing their own antibiotics, this trait does not currently exist in the cow population. This means that there is no gene or set of genes that can be selected for to produce cows that produce their own antibiotics.
Options A, B, and C are incorrect because they are not true. Antibiotics are used in veterinary medicine to treat bacterial infections in cows, so it is not the case that antibiotics are used only in humans. The pathway for antibiotic production requires a number of enzymes, but this would not prevent artificial selection from being used. And while cows do not possess the same specialized organs as some other creatures that produce antibiotics, they do possess immune systems that produce a range of antimicrobial peptides, which act like natural antibiotics.
(Please could you kindly mark my answer as brainliest you could also follow me so that you could easily reach out to me for any other questions)
all of the following characteristics are seen in phylum arthropoda except group of answer choices bilateral symmetry. an open circulatory system. protostome development. a pseudocoelom. three embryonic germ layers.
Bilateral symmetry is not seen in phylum Arthropoda, as these organisms possess an exoskeleton and typically have a segmented body plan that does not result in bilateral symmetry. Instead, Arthropods typically have radial symmetry, which can be seen in the body of a spider or butterfly.
Other characteristics of Arthropods include an open circulatory system, where the heart pumps hemolymph (the arthropod version of blood) throughout the body, protostome development, which is the development of a digestive system from a hollow blastula, a pseudocoelom, which is a body cavity formed from mesoderm and not lined by epithelium, and three embryonic germ layers, which are endoderm, mesoderm, and ectoderm.
Know more about Bilateral symmetry here
https://brainly.com/question/15970176#
#SPJ11
which of the following is an example of species interaction(s) leading to adaptive radiation? which of the following is an example of species interaction(s) leading to adaptive radiation? a flower has evolved to be pollinated by many different species of unrelated insects; these insects also pollinate many different species of flowers. flowers grow to different heights at different altitudes on a mountain. when grown in a common garden these organisms can interbreed and grow to different heights that reflect their host population mean height. a flower is pollinated by different members of the same genus of insect during different times of day. species a pollinates in early morning, species b visits in the late morning, species c visits during mid-day, and species d collects nectar and pollen in the evening. a flower has evolved in tandem with its pollinator and relies on it exclusively for pollination and sexual reproduction. flowers grow to different heights at different altitudes on a mountain. when grown in a common garden these organisms can interbreed and grow to similar heights.
An example of species interaction(s) leading to adaptive radiation is the flower that has evolved to be pollinated by many different species of unrelated insects; these insects also pollinate many different species of flowers (A).
The evolutionary process whereby one species gives rise to several species that adapt to different ecological niches is known as adaptive radiation. Adaptive radiation is a mechanism by which a single species becomes multiple species that live in different environments and have unique characteristics. This happens because the original species divides into several new species that are better adapted to their environments.
Adaptive radiation is a result of environmental pressures. It occurs when a single ancestral species diversifies into many descendant species. For example, a flower has evolved to be pollinated by many different species of unrelated insects and these insects also pollinate many different species of flowers.
Your options aren't well arranged, but most probably your options were
A. a flower has evolved to be pollinated by many different species of unrelated insects; these insects also pollinate many different species of flowers.
B. flowers grow to different heights at different altitudes on a mountain. when grown in a common garden these organisms can interbreed and grow to different heights that reflect their host population mean height.
C. a flower is pollinated by different members of the same genus of insect during different times of day. Species a pollinates in early morning, species b visits in the late morning, species c visits during mid-day, and species d collects nectar and pollen in the evening.
D. a flower has evolved in tandem with its pollinator and relies on it exclusively for pollination and sexual reproduction.
flowers grow to different heights at different altitudes on a mountain. when grown in a common garden these organisms can interbreed and grow to similar heights.
Thus, the correct option is A.
For more information about adaptive radiation refers to the link: https://brainly.com/question/14154757
#SPJ11
in angiosperm embryo seed, how many cells are formed?
The number of cells that form in an angiosperm embryo seed is 8 cells. The cells are endosperm contains three cells, the suspensor cells contain two, and the embryo sac and the integuments each contain one cell.
Angiosperms are flowering plants that makeup one of the two main groups of seed plants (the other is gymnosperms). They are referred to as angiosperms because they produce seeds in flowers, which are covered by the fruit. Almost 80% of all known plants are angiosperms, and they can be found in almost any terrestrial environment. In angiosperm (flowering plant) embryo seeds, there are typically two types of cells formed during embryogenesis: the embryo proper and the suspensor.
Learn more about angiosperm: https://brainly.com/question/25768035
#SPJ11
breanna and kevin learned that fossil fuels, such as coal and oil, release energy when they are burned. breanna believes this energy comes from the ancient plants and animals that formed fossil fuels, but kevin says the energy in fossil fuels comes from the sun. explain who is right and why.
Answer: Breanna is correct.
Explanation: When fossil fuels are burned the ancient plants and animals inside create carbon and all that heat turns water into steam which goes into power turbines to create energy.
What is the metabolic pathway that releases energy by breaking down complex molecules into smaller, simpler compounds?
The metabolic pathway that releases energy by breaking down complex molecules into smaller, simpler compounds is called catabolism. Catabolism involves breaking down large molecules, like carbohydrates and proteins, into smaller molecules such as water, carbon dioxide, and energy.
Metabolism refers to all of the chemical reactions that occur in a cell or organism. It includes both anabolism and catabolism. Anabolism refers to the process of building larger, more complex molecules from smaller, simpler ones. Catabolism, on the other hand, refers to the process of breaking down larger, more complex molecules into smaller, simpler ones. During catabolism, energy is released from the chemical bonds of the larger molecules, this energy can be used to power cellular processes or stored for later use.
Learn more about catabolism: https://brainly.com/question/12875784
#SPJ11
Which of the following is a common danger of commercial fishing?
A.An increase in biodiversity
B.Improved water quality
C. An improved human diet
D. An increase in human fatality
Answer: D
Explanation:
what part of the temporal bone does the mandible articulate with?
what explains the differences among the four illustrations? is there anything that confirms or contradicts the order in which you arranged the illustrations?
The differences among the four illustrations are due to the presence of lave and mutation within the population of mice. There is no information that confirms or contradicts the order in which the illustrations are arranged.
The illustrations likely depict a population of mice with varying characteristics, such as fur color, tail length, or other physical features. These differences may be due to genetic mutations that have arisen over time or to the presence of different genetic variations within the population.
Additionally, environmental factors, such as availability of food or predation pressure, may also contribute to differences among the mice. However, without more information, it is not possible to confirm or contradict the order in which the illustrations are arranged, as the order may have been arbitrary or based on some other criteria.
To know more about illustrations, here
brainly.com/question/28298427
#SPJ4
Obligate anaerobes which are sensitive to O2 would be found growing
A. only at the very top of a tube of thioglycolate broth
B. approximately one-third of the way down the thioglycolate broth.
C. only at the bottom of a tube of thioglycolate broth.
D. throughout a tube of thioglycolate broth.
Answer:
Explanation:
Obligate anaerobes are microorganisms that require an oxygen-free environment to grow and are sensitive to oxygen. Thioglycolate broth is a common culture medium used for growing microorganisms and is commonly used to test the oxygen requirements of bacteria.
The medium in a tube of thioglycolate broth is rich in nutrients and contains a reducing agent, which helps to create an anaerobic environment in the lower part of the tube. The oxygen concentration gradually decreases as you move down the tube, and the concentration of reducing agents increases.
Based on this information, we can determine that obligate anaerobes that are sensitive to O2 would be found growing at the bottom of a tube of thioglycolate broth, where the oxygen concentration is lowest and the environment is most anaerobic. Therefore, the correct answer is option C: only at the bottom of a tube of thioglycolate broth.
if you were writing about hylobates agilis and homo neanderthalensis at the same time, would you need to change your abbreviations? why or why not? if you needed to change them, what would the new abbreviations be?
Yes, you would need to change your abbreviations. The abbreviation for Hylobates agilis is H. agilis, while the abbreviation for Homo neanderthalensis is H. neanderthalensis.
If both species are being discussed in the same document, it is important to differentiate between the two. This can be done by changing the abbreviations so that they are more distinct.
For example, H. agilis could become H. a. and H. neanderthalensis could become H. n. These more distinct abbreviations will serve to avoid confusion and help differentiate which species is being referred to.
Know more about Hylobates agilis here
https://brainly.com/question/8703871#
#SPJ11
does the difference in sensitivity between the fingertip and the back of the neck help our bodies to maintain homeostasis? if so, in what way?
While the sensitivity differences between the fingertips and the back of the neck are not directly related to homeostasis, they do play a role in the body's ability to respond to external stimuli and maintain overall health and wellbeing.
The difference in sensitivity between the fingertips and the back of the neck is due to variations in the density and distribution of sensory receptors in the skin. While the fingertips have a high concentration of touch receptors, the back of the neck has fewer and less sensitive receptors.
In terms of maintaining homeostasis, the sensitivity differences between these areas do not have a direct role. Homeostasis refers to the body's ability to maintain a stable internal environment, and it involves a range of physiological processes such as temperature regulation, fluid balance, and metabolic homeostasis.
However, the sensitivity differences in different areas of the skin can play a role in the body's response to external stimuli, such as temperature changes, pressure, and pain. The fingertips, for example, are highly sensitive to touch and pressure, which can help us detect and respond to changes in the environment. Meanwhile, the back of the neck is less sensitive, which may help to prevent overstimulation and fatigue.
To know more about homeostasis
brainly.com/question/25864161
#SPJ4
cercopithecines are primarily terrestrial quadrupeds and omnivorous. group of answer choices true false
The given statement "Cercopithecines are primarily terrestrial quadrupeds and omnivorous" is true. Because they are adapted to life on the ground and are often found in open habitats such as grasslands, savannas, and forests.
Cercopithecines are a subfamily of Old World monkeys that includes many species of terrestrial quadrupeds and omnivores. Cercopithecines are generally terrestrial and adapted to life on the ground, but some species are also arboreal (tree-dwelling).
They have a diverse diet that includes fruits, leaves, insects, and small animals, and their teeth and digestive system are adapted to process a wide range of food items. While some cercopithecine species are arboreal (tree-dwelling), the majority of them are primarily terrestrial.
Cercopithecines are important to the ecosystem as seed dispersers and predators of insects and small animals. However, they are also sometimes considered pests, as they can damage crops and raid human settlements for food.
To know more about Cercopithecines here
https://brainly.com/question/25676394
#SPJ4
What is interspecific competition?
What is direct competition?
If the population of a species increases or decreases, what happens to the species that consumes them?
What is adaptation?
What is a mutation?
What is genetic drift?
Why is genetic variation beneficial?
What is altruistic behavior? Give an example.
How are artificial selection and genetic modification similar?
What is natural selection?
Are organisms able to adapt to their environment quickly?
What was mostly responsible for the “great dying”?
The competition between members of different species is called interspecific competition.
What is an example of adaptation?A variation can be underlying, meaning it is an actual piece of the organic entity. Behavioral adaptations can also affect an organism's response to its environment. An illustration of an underlying transformation is the manner in which a few plants have adjusted to life in dry, hot deserts.
An illustration of mutation?A transformation is a change that happens in our DNA grouping, either because of slip-ups when the DNA is replicated or as the consequence of natural factors, for example, UV light and tobacco smoke.
To know more about species visit :-
https://brainly.com/question/13259455
#SPJ1
Answer:
The competition between members of different species is called interspecific competition.
Explanation: