Answer:
The adaptations are result of both the environment and genes. Animal develop adaptive characteristics in response to their environmental challenges. These adaptations help the animals survive in their environment. The animals are more likely to reach reproductive age. So,these adaptive traits are more likely to be passed on to offspring.In the case of cheetahs,tan coloring,conservation of water, and fast legs are traits that help them survive in the savanna. These traits,like all the other characteristics of cheetahs,are genetically passed from parents to offspring.
Explanation:
if it helped you please mark me a brainliest :))
Which statement best describes the law of conservation of energy?
A. Energy can be destroyed but not created.
B. The total energy in an open system can only decrease.
C. Energy can change forms but cannot be created or destroyed.
D. Energy can be created but not destroyed.
What did Malala's dad mean when he said, "It's a good thing to come in second." (Ch. 5)
A: Winning all the time can make kids not want
to play with you.
B: No one is perfect.
C: You should learn to be a good loser, not just
a good winner.
D: It is good to sometimes let others win.
Answer:
Based on the context provided, Malala's dad likely meant that "It's a good thing to come in second" because "You should learn to be a good loser, not just a good winner."
Suggest why it is very difficult to eradicate an introduced species,
once it has settled into a new place.
Answer: This is because they might not have any predators or there NATURAL ENVIROMENT IS DIFFICULT to find or destroy
Explanation:
Which of the following is not a common reason why individuals or groups use the ocean to dump our garbage?
Companies opt to save money by using ocean dumping.
Governments have limited funds for proper garbage disposal.
Ocean waters increase the rate of decomposition of garbage.
Landfills or incineration are not possible for a town or city.
Answer: Ocean waters increase the rate of decomposition of garbage.
Explanation: I took the quiz
You are running a peach farm on western slopes of Colorado. You know that the allele for fuzzy peaches is recessive and that this allele (f) has frequency of 0.7. In a sampling of 500 peaches. How many fuzzy peaches do you expect to find?
Given that the allele for fuzzy peaches is recessive and has a frequency of 0.7. This means that the frequency of the dominant allele (F) will be (1-0.7) = 0.3.
Let's use the Hardy-Weinberg equation to calculate the expected number of fuzzy peaches in a sample of 500:
p^2 + 2pq + q^2 = 1
where
p = frequency of the dominant allele (F) = 0.3
q = frequency of the recessive allele (f) = 0.7
The genotype frequencies can be calculated as follows:
FF = p^2 = (0.3)^2 = 0.09
Ff = 2pq = 2(0.3)(0.7) = 0.42
ff = q^2 = (0.7)^2 = 0.49
The expected frequency of fuzzy peaches (ff) is 0.49. Therefore, the expected number of fuzzy peaches in a sample of 500 would be:
Number of fuzzy peaches = expected frequency of fuzzy peaches x sample size
= 0.49 x 500
= 245
Therefore, you would expect to find 245 fuzzy peaches in a sample of 500.
What causes a mountain breeze?
• A. The sides of the valley cooling off more quickly than the air around
it.
B. The albedo of clouds.
C. The difference in heating between freshwater and seawater
D. The difference in specific heat between altitudes.
SUBMIT
Answer:
D. The difference in specific heat between altitude
Explanation:
Hop it helps
Please mark brainliest
The graphs represent the growth of two populations of
American bullfrogs in neighboring habitats.
Population
Habitat A
Time
Population
Habitat B
Time
Which statement is supported by the information provided?
A. Habitat A has more living space that is suitable for bullfrogs.
O B. Habitat B has more predators of bullfrogs.
O C. Habitat B contains more resources for bullfrogs.
O D. Habitat A can support a larger population of bullfrogs.
Eat natural food. By reducing pesticide and fertilizer use, you at once assist in reducing the quantity of chemical contamination that affects many amphibian species. Avoid releasing environmental estrogens into the water.
What is the habitat choice of the American bullfrog?A. Habitat A has greater living area that is suitable for bullfrogs. O B. Habitat B has extra predators of bullfrogs. O C. Habitat B consists of more sources for bullfrogs. O D. Habitat A can aid a larger population of bullfrogs.
American bullfrogs occupy a extensive vary of each herbal and manmade habitats, inclusive of lakes, ponds, swamps, marshes, brackish waters, streams, rivers, ditches, and canals. They pick warm, sluggish or stagnant waters with abundant vegetation, however are additionally observed along the shores of lakes and banks of streams.
Learn more about neighboring here;
https://brainly.com/question/15668415
#SPJ1
As global meat production continues to rise, more and more of Earth’s land will be converted to agricultural land. As a result, the negative impacts of land use on wild species and their habitats will also increase.
In a recent study, a group of scientists looked at how an increase in agricultural land from 2010 to 2050 would affect different species. The study examined nearly
20,000, amphibian, bird, and mammal species. For each species, the scientists predicted if it would gain, lose, or have no change in habitat due to new agricultural land. Their results are given in the table below.
Approximately what percent of the species are predicted to lose habitat by 2050?
Round your answer to the nearest whole percent.
Without numeric data or a data table, we can't calculate the percentage. However, generally the percentage is found by dividing the number predicted to lose habitat by the total, then multiply by 100.
Explanation:The provided question does not contain any numerical data or a data table, thus we can't calculate the percentage of species predicted to lose habitat by 2050. However, assuming you have the necessary data from the study including the total number of species and the number predicted to lose habitat, you would divide the number of species predicted to lose habitat by the total number of species, then multiply the result by 100 to get the percentage. Ensure to round off your answer to the nearest whole percent as requested.
Learn more about Percentage Calculation here:https://brainly.com/question/329987
#SPJ2
In what meiotic stage does crossing over occur?
In the metaphase which is a meiotic stage crossing occurs.
What is a meiotic stage?Meiosis seems to be a process of cell division that typically results in the production of four gamete cells and just a 50% reduction in the number of chromosomes there in the parent cell. To develop the cells that makeup eggs and sperm during sexual reproduction, this procedure must be performed.
When every one of the chromosomes is lined up in the center of the cell during metaphase, attempting to cross over takes place. They can cross across because they are so close together. They can cross across because they are so close together. Crossing crossover occurs in anaphase on every pole of the animal cell where other chromosomes are crowded tightly.
Learn more about the meiotic stage, here:
https://brainly.com/question/30245723
Finish the statement. Differences in temperature cause movement of air. This sinking of cold air and rising of warm air is the way heat moves in Solids Convection Evaporation Radiation
One way to discourage food sovereignty would be to:
Please choose the correct answer from the following choices, and then select the submit answer button.
Answer choices
promote local control of land, seeds, and other needed agricultural resources.
encourage food growth for export.
value food providers' right to live and work with dignity.
recognize that solutions must be place-based.
Answer:
Encouraging food growth for export would be one way to discourage food sovereignty
Explanation:
.This is because if the focus is on exporting food, it may lead to a situation where the domestic market is neglected, and food production is not geared towards meeting local needs. This could result in food shortages and make the local population dependent on imported food. In such a scenario, the control over food production and distribution would lie with external forces rather than local communities, which goes against the idea of food sovereignty.
What is the term for the process by which mRNA is used to make a protein?
The term for the process by which mRNA is used to make a protein is "translation".
Translation is a key process in gene expression, whereby the sequence of nucleotides in mRNA is read and used to synthesize a protein. During translation, the mRNA is read by ribosomes, which use the sequence of nucleotides to assemble a specific sequence of amino acids into a protein. The sequence of amino acids determines the structure and function of the protein, and ultimately its role in the cell or organism.
The process of translation involves a complex series of steps, including the recognition and binding of mRNA by ribosomes, the selection and assembly of amino acids, and the folding and modification of the protein. Understanding the process of translation is essential for understanding the fundamental workings of cells and organisms, and has important implications for fields such as biotechnology and medicine.
How does horizontal gene transfer differ from vertical gene transfer?
Answer:
the acquisition of genetic material from an ancestor.
Explanation:
hope this helps
What is speciation? Describe the three things required.
Speciation is the evolutionary process by which new species arise from existing ones.
What is speciation?Speciation occurs when a group of organisms becomes reproductively isolated from the rest of their population, preventing gene flow between the two groups.
There are three key requirements for speciation to occur:
Genetic isolation: This occurs when a group of individuals becomes separated from the rest of their population, either geographically or ecologically, and is prevented from interbreeding with them. This can lead to the accumulation of genetic differences between the two groups.
Genetic divergence: Once genetic isolation occurs, the two populations can begin to evolve separately. This can happen as a result of genetic drift, natural selection, or other evolutionary mechanisms, leading to the accumulation of genetic differences between the two groups.
Reproductive isolation: Over time, the genetic differences between the two groups may become so pronounced that members of the two populations are no longer able to interbreed successfully, even if they are brought back into contact with one another.
Learn more about speciation at: https://brainly.com/question/2113835
#SPJ1
Why did Darwin compare his theory of natural selection to Copernicus's theory that Earth orbited the Sun?
The heliocentric theory of the cosmos, developed by Copernicus's theory, moved humans away from the actual centre of the universe. A theory of evolution was created by Charles Darwin.
What parallels exist between the Copernican and Darwinian revolutions?It is possible to think of the Copernican and Darwinian Revolutions as the two phases of a single Scientific Revolution. Together, they marked the beginning of science in the contemporary sense: the study of natural laws as explanations.
What distinguishes Darwin's theory of evolution from the concept of natural selection?According to the Darwinian Theory of Evolution, natural selection, which drives evolution, is skewed by the traits that organisms inherit from their ancestors. The capacity for adaptation is what aids organisms in natural selection-based evolution.
To know more about Copernicus's theory visit :-
https://brainly.com/question/22477117
#SPJ1
30. What is the potential where a cell membrane must be more positive than negative to initiate an impulse?
A.action potential
B.stimulus
C.threshold potential
D.membrane potential
The threshold potential is the value at which a cell membrane must be more positively charged than negatively charged in order to produce an impulse.
Threshold potentialThe threshold potential is a crucial depolarization level that must be attained in order for a neuron to initiate an action potential or nerve impulse.
Voltage-gated ion channels in the membrane of a neuron open when the membrane potential reaches the threshold potential, enabling an influx of positively charged ions into the cell.
The result is a fast depolarization of the cell membrane, which generates an action potential that travels the entire length of the neuron.
It's crucial to understand that the threshold potential varies depending on the kind and location of the neuron, in addition to other elements like temperature and the presence of toxins or medications.
learn more about impulse here
https://brainly.com/question/477839
#SPJ1
In dragons, blue horns
(B) are dominant to
yellow horns (b).
What percent of these
offspring would have
yellow horns?
50%
75%
0%
25%
The answer is 25 percent
What observation proves that a cell is a eukayote?
COMMUNITY
Define:
Describe interactions:
Examples of interactions:
Answer:
a group of people living in the same place or having a particular characteristic in common.
"the scientific community"
Explanation:
a forest of trees and undergrowth plants, inhabited by animals and rooted in soil containing bacteria and fungi
Transcribe and translate the following strands of DNA. Then answer the questions about protein synthesis.
1. DNA: TACCATCGATTGGAAGACCTTAACGAGCTAACT
mRNA:
amino acids:
2. DNA: CTGTTACTTTCAATCGTACACCAACACTGCTTTC
mRNA:
amino acids:
Answer:
so I don't know this one but will tell you how to solve it.
Explanation:
During transcription, the enzyme RNA polymerase (green) uses DNA as a template to produce a pre-mRNA transcript (pink). The pre-mRNA is processed to form a mature mRNA molecule that can be translated to build the protein molecule (polypeptide) encoded by the original gene.
Identify 3 imaging technologies that are used to determine the structure of plants. For
one of these technologies, briefly outline its use.
Answer:
Abstract
Given the rapid development of plant genomic technologies, a lack of access to plant phenotyping capabilities limits our ability to dissect the genetics of quantitative traits. Effective, high-throughput phenotyping platforms have recently been developed to solve this problem. In high-throughput phenotyping platforms, a variety of imaging methodologies are being used to collect data for quantitative studies of complex traits related to the growth, yield and adaptation to biotic or abiotic stress (disease, insects, drought and salinity). These imaging techniques include visible imaging (machine vision), imaging spectroscopy (multispectral and hyperspectral remote sensing), thermal infrared imaging, fluorescence imaging, 3D imaging and tomographic imaging (MRT, PET and CT). This paper presents a brief review on these imaging techniques and their applications in plant phenotyping. The features used to apply these imaging techniques to plant phenotyping are described and discussed in this review.
Keywords: phenotyping phenotype, fluorescence imaging, thermal infrared imaging, visible light imaging, imaging spectroscopy, three dimensional imaging
1. Introduction
To ensure that crop production is sufficient to satisfy the needs of a human population that is expected to grow to more than 9 billion by 2050 is a tremendous challenge for plant science and crop improvement [1]. This goal is challenging primarily because the average rate of crop production increase is only 1.3% per year, and it cannot keep pace with population growth. By connecting the genotype to the phenotype, high yielding, stress-tolerant plants can be selected far more rapidly and efficiently than is currently possible. Advances in techniques such as next generation DNA sequencing can be made available to breeders to provide potential increases in the rate of genetic improvement by molecular breeding [2]. However, the lack of access to phenotyping capabilities limits our ability to dissect the genetics of quantitative traits related to growth, yield and adaptation to stress. Plant breeders and farmers were making selections based on phenotypes long before the discovery of DNA and molecular markers. To identify the best genetic variation, the more crosses and environments that are used for selection, the greater the probability of identifying a superior variation. To meet future requirements, there is a need to increase breeding efficiency. Advances in high throughput genotyping have offered fast and inexpensive genomic information and paved the way for the development of large mapping populations and diversity panels of thousands of recombinant inbred lines for phenotyping [3]. Although molecular breeding strategies have placed greater focus on selections based on genotypic information, they still require the following phenotypic data [4]: (1) phenotypes are used for selection and to train a prediction model in genomic selection; (2) a single phenotyping cycle is used to identify markers for subsequent selection through generations within the maker-assisted recurrent selection [5]; and (3) phenotyping is necessary to identify promising events in transgenic studies [6]. Phenotyping advances are essential for capitalizing on developments in conventional, molecular, and transgenic breeding.
Explanation:
The basic unit of life is a cell. A student is studying for an exam comparing structure and functions of a plant cell and an animal cell. The student has to be able to identify the different organelles and the most likely location. Which type of proposed model would be best for the student to utilize in their studies and why?
A) The student should utilize a mathematical model comparing the percent of types of organelles in each so that they understand
the amount in each type of cell.
B) The student should utilize a hand-held size physical model of each type of cell so that they are able to see and compare the types
and locations of the organelles and how the organelle’s functions relate.
C) The student should utilize microscopic slides with real animal and plant cells so that they are able to identify the organelles and
location in a real cell and not a pretend one.
D) The student should utilize a model of the human body and plant so that they can understand how the cells of each type work with
the rest of the structure.
E) The student should utilize a conceptual model that differentiates between the animal cell and plant cell in general and which type
of cell is better.
Answer: E) The student should utilize a conceptual model that differentiates between the animal cell and plant cell in general and which type
of cell is better.
Explanation:
Structurally, plant and animal cells are very similar because they are both eukaryotic cells. They both contain membrane-bound organelles such as the nucleus, mitochondria, endoplasmic reticulum, golgi apparatus, lysosomes, and peroxisomes. Both also contain similar membranes, cytosol, and cytoskeletal elements.
Both animal and plant cells have mitochondria, but only plant cells have chloroplasts.
Animal cells have centrioles, centrosomes (discussed under the cytoskeleton), and lysosomes, whereas plant cells do not. Plant cells have a cell wall, chloroplasts, plasmodesmata, and plastids used for storage, and a large central vacuole, whereas animal cells do not.
The different types of plant cells include- collenchyma, sclerenchyma, parenchyma, xylem, and phloem.
. Explain the reciprocal relationship the dolphins have with the fishermen in Laguna.
Answer:
Parasitism
Explanation:
One is benefit on the other hand the other is harmed
Dolphins are friendly animals to humans on the other hand humans can harm or torture dolphins by training them on force or kill them
Describe four different types of drugs and their impact on sports performance
Evaluate the impact of four different performance-enhancing drugs on performance in four different types of sport
Discuss, using relevant examples, why some individuals may resort to using performance-enhancing drugs in sport
Humans belong to order___________ and family _________
Answer:
primate order and homo sapiens
Explanation:
In order to perform work on an object, you must apply a
[ Select I
[ Select I
[ Select ]
Heat
Distance
Time
Potential Energy
Temperature
Kinetic Energy
Force
Answer:
Distance is the answer
Explanation:
According to the formula of work
Work: Force × Distance
Hence distance must be applied to perform work
Answer:
force
Explanation:
force is the application to apply potential energy to perform the work
You are running a peach farm on the western slopes of Colorado. You know that the allele for fuzzy peaches is recessive and that this allele (f) has frequency of 0.7. You count 250 fuzzy peaches and 250 bald peaches. Determine whether or not this population is still in Hardy Weinberg equilibrium
This population is not in Hardy-Weinberg equilibrium, and there is some evolutionary force at work (such as mutation, selection, or genetic drift) causing the observed deviation from expected genotype frequencies.
To determine whether or not the population is in Hardy-Weinberg equilibrium, we can use the Hardy-Weinberg equation:
p²2 + 2pq + q² = 1
where p is the frequency of the dominant allele (in this case, the allele for bald peaches), q is the frequency of the recessive allele (the allele for fuzzy peaches), p² is the frequency of homozygous dominant individuals (bald-bald), 2pq is the frequency of heterozygous individuals (bald-fuzzy), and q² is the frequency of homozygous recessive individuals (fuzzy-fuzzy).
In this case, we are given that q (the frequency of the fuzzy allele) is 0.7. We can calculate p as:
p = 1 - q
p = 1 - 0.7
p = 0.3
We can then use the equation to calculate the expected frequencies of each genotype:
p² = (0.3)² = 0.09
2pq = 2(0.3)(0.7) = 0.42
q² = (0.7)² = 0.49
We can convert these expected frequencies to expected counts by multiplying by the total number of individuals:
Expected count of bald-bald (p²): 0.09 x 500 = 45
Expected count of bald-fuzzy (2pq): 0.42 x 500 = 210
Expected count of fuzzy-fuzzy (q²): 0.49 x 500 = 245
We can then compare these expected counts to the observed counts (250 fuzzy peaches and 250 bald peaches) to see if they are significantly different. We can use a chi-square goodness-of-fit test to make this comparison:
chi-square = ∑((observed - expected)² / expected)
chi-square = ((250 - 245)² / 245) + ((250 - 210)² / 210) + ((0 - 45)² / 45)
chi-square = 1.96 + 24.4 + 45
chi-square = 71.36
To determine if this chi-square value is significant, we need to compare it to the critical value from a chi-square distribution with 2 degrees of freedom (3 genotypes - 1). The critical value is 5.99 when the significance level is set to 0.05. We can rule out the null hypothesis that the population is in Hardy-Weinberg equilibrium since our computed chi-square value (71.36) is higher than the crucial value (5.99).
Learn more about Hardy-Weinberg equilibrium here:
https://brainly.com/question/30972392
#SPJ1
Circle the correct words to complete the sentences.
• Human insulin is now made with a biotechnology called [genetic
engineering/selective breeding].
• After scientists [copy/remove] the gene for insulin from a human cell, the gene is inserted into the DNA of [a bacterial/another human] cell.
•After the combined DNA is placed inside a [bacterial/human] cell, it becomes a [bioreactor/transgenic] organism that makes human insulin.
Answer:
Human insulin is now made with a biotechnology called [genetic engineering/selective breeding]. (Genetic engineering)
• After scientists [copy/remove] the gene for insulin from a human cell, the gene is inserted into the DNA of [a bacterial/another human] cell. (Copy, a bacterial)
• After the combined DNA is placed inside a [bacterial/human] cell, it becomes a [bioreactor/transgenic] organism that makes human insulin. (bacterial, bioreactor)
The are 5 different types of white blood cells. Looking at their names, how would you categorize them into two groups?
Answer:
The five types of white blood cells are neutrophils, lymphocytes, monocytes, eosinophils, and basophils. They can be categorized into two groups based on their staining properties: granulocytes (neutrophils, eosinophils, and basophils) and agranulocytes (lymphocytes and monocytes).
Explanation:
4. If one parent of a couple has Huntington's disease (assume that this parent is
heterozygous), calculate the fraction of their children that would be expected to
develop the disease. What if both parents were heterozygous?
If one parent of a couple has Huntington's disease , 50 percent of their children that would be expected to develop the disease if both parents were heterozygous.
What is Huntington's disease ?Huntington's disease is a brain condition in which brain cells, or neurons, in specific areas of the brain begin to degrade. As the neurons degenerate, the illness can cause hormonal disturbances, cognitive decline, and uncontrolled movements. Huntington's disease is a hereditary condition. It is handed down from generation to generation. If one of the parents has Huntington's disease, the child has a 50% risk of developing it as well. If the child does not contract the disease, he or she will not pass it on to their offspring. There is no family history of Huntington disease in 1% to 3% of individuals who have the disease.
What is heterozygous condition ?In genetics, heterozygous means having received different versions (alleles) of a genomic marker from each biological parent. As a result, a person who is heterozygous for a genomic marker has two distinct forms of that marker.
To know more about Huntington's disease , visit ;
brainly.com/question/12572808
#SPJ1